  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT11471 2 ug
EUR 273
TMED7 cloning plasmid
CSB-CL896886HU-10ug 10ug
EUR 299
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgccgcggccggggtccgcgcagcgctgggcggccgtcgcgggccgttgggggtgcaggctgctcgcactgctgctactggtgcctggacccggcggcgcctctgagatcaccttcgagcttcctgacaacgccaagcagtgcttctacgaggacatcgctcagggcaccaagtg
  • Show more
Description: A cloning plasmid for the TMED7 gene.
ELI-29359h 96 Tests
EUR 824
Rat TMED7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TMED7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMED7 Recombinant Protein (Rat)
RP233402 100 ug Ask for price
TMED7 Recombinant Protein (Human)
RP031831 100 ug Ask for price
TMED7 Recombinant Protein (Mouse)
RP179165 100 ug Ask for price
Tmed7 ORF Vector (Rat) (pORF)
ORF077802 1.0 ug DNA
EUR 506
TMED7 ORF Vector (Human) (pORF)
ORF010611 1.0 ug DNA
EUR 95
Tmed7 ORF Vector (Mouse) (pORF)
ORF059723 1.0 ug DNA
EUR 506
TMED7-TICAM2 Recombinant Protein (Human)
RP101930 100 ug Ask for price
Tmed7 sgRNA CRISPR Lentivector set (Rat)
K7473701 3 x 1.0 ug
EUR 339
Tmed7 sgRNA CRISPR Lentivector set (Mouse)
K3169001 3 x 1.0 ug
EUR 339
TMED7 sgRNA CRISPR Lentivector set (Human)
K2385601 3 x 1.0 ug
EUR 339
TMED7-TICAM2 ORF Vector (Human) (pORF)
ORF033978 1.0 ug DNA Ask for price
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7473702 1.0 ug DNA
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7473703 1.0 ug DNA
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7473704 1.0 ug DNA
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3169002 1.0 ug DNA
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3169003 1.0 ug DNA
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3169004 1.0 ug DNA
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector set (Human)
K2811201 3 x 1.0 ug
EUR 339
TMED7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385602 1.0 ug DNA
EUR 154
TMED7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385603 1.0 ug DNA
EUR 154
TMED7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385604 1.0 ug DNA
EUR 154
TMED7 Protein Vector (Rat) (pPB-C-His)
PV311206 500 ng
EUR 603
TMED7 Protein Vector (Rat) (pPB-N-His)
PV311207 500 ng
EUR 603
TMED7 Protein Vector (Rat) (pPM-C-HA)
PV311208 500 ng
EUR 603
TMED7 Protein Vector (Rat) (pPM-C-His)
PV311209 500 ng
EUR 603
TMED7 Protein Vector (Mouse) (pPB-C-His)
PV238890 500 ng
EUR 603
TMED7 Protein Vector (Mouse) (pPB-N-His)
PV238891 500 ng
EUR 603
TMED7 Protein Vector (Mouse) (pPM-C-HA)
PV238892 500 ng
EUR 603
TMED7 Protein Vector (Mouse) (pPM-C-His)
PV238893 500 ng
EUR 603
TMED7 Protein Vector (Human) (pPB-C-His)
PV042441 500 ng
EUR 329
TMED7 Protein Vector (Human) (pPB-N-His)
PV042442 500 ng
EUR 329
TMED7 Protein Vector (Human) (pPM-C-HA)
PV042443 500 ng
EUR 329
TMED7 Protein Vector (Human) (pPM-C-His)
PV042444 500 ng
EUR 329
Tmed7 3'UTR Luciferase Stable Cell Line
TU120604 1.0 ml Ask for price
Tmed7 3'UTR GFP Stable Cell Line
TU170604 1.0 ml Ask for price
Tmed7 3'UTR Luciferase Stable Cell Line
TU221990 1.0 ml Ask for price
TMED7 3'UTR GFP Stable Cell Line
TU075701 1.0 ml
EUR 1521
Tmed7 3'UTR GFP Stable Cell Line
TU271990 1.0 ml Ask for price
TMED7 3'UTR Luciferase Stable Cell Line
TU025701 1.0 ml
EUR 1521
TMED7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV698689 1.0 ug DNA
EUR 514
TMED7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV698693 1.0 ug DNA
EUR 514
TMED7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV698694 1.0 ug DNA
EUR 514
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2811202 1.0 ug DNA
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2811203 1.0 ug DNA
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2811204 1.0 ug DNA
EUR 154
TMED7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV793105 1.0 ug DNA
EUR 316
TMED7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV793106 1.0 ug DNA
EUR 316
TMED7-TICAM2 Protein Vector (Human) (pPB-C-His)
PV135910 500 ng Ask for price
TMED7-TICAM2 Protein Vector (Human) (pPB-N-His)
PV135911 500 ng Ask for price
TMED7-TICAM2 Protein Vector (Human) (pPM-C-HA)
PV135912 500 ng Ask for price
TMED7-TICAM2 Protein Vector (Human) (pPM-C-His)
PV135913 500 ng Ask for price
TMED7-TICAM2 3'UTR GFP Stable Cell Line
TU075702 1.0 ml
EUR 2333
TMED7-TICAM2 3'UTR Luciferase Stable Cell Line
TU025702 1.0 ml
EUR 2333
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7473705 3 x 1.0 ug
EUR 376
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3169005 3 x 1.0 ug
EUR 376
TMED7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2385605 3 x 1.0 ug
EUR 376
TMED7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV698690 1.0 ug DNA
EUR 514
TMED7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV698691 1.0 ug DNA
EUR 572
TMED7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV698692 1.0 ug DNA
EUR 572
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7473706 1.0 ug DNA
EUR 167
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7473707 1.0 ug DNA
EUR 167
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7473708 1.0 ug DNA
EUR 167
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3169006 1.0 ug DNA
EUR 167
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3169007 1.0 ug DNA
EUR 167
Tmed7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3169008 1.0 ug DNA
EUR 167
TMED7-TICAM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2811205 3 x 1.0 ug
EUR 376
TMED7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2385606 1.0 ug DNA
EUR 167
TMED7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2385607 1.0 ug DNA
EUR 167
TMED7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2385608 1.0 ug DNA
EUR 167