  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27 Antibody

ABD9129 100 ug
EUR 438

RPL27 antibody

70R-2387 50 ug
EUR 467
Description: Rabbit polyclonal RPL27 antibody raised against the middle region of RPL27

RPL27 Antibody

45730-100ul 100ul
EUR 252

RPL27 Antibody

45730-50ul 50ul
EUR 187

RPL27 antibody

70R-19975 50 ul
EUR 435
Description: Rabbit polyclonal RPL27 antibody

RPL27 antibody

70R-15200 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody

RPL27 Antibody

DF9129 200ul
EUR 304
Description: RPL27 Antibody detects endogenous levels of total RPL27.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL27 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


PVT18575 2 ug
EUR 231

RPL27 Conjugated Antibody

C45730 100ul
EUR 397

RPL27 cloning plasmid

CSB-CL020213HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: atgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaa
  • Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 cloning plasmid

CSB-CL020213HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgatcaaaacaaagcatctaaaaccgcagtttctggaagaaccacttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagc
  • Show more
Description: A cloning plasmid for the RPL27 gene.

anti- RPL27 antibody

FNab07426 100µg
EUR 548.75
  • Immunogen: ribosomal protein L27
  • Uniprot ID: P61353
  • Gene ID: 6155
  • Research Area: Metabolism
Description: Antibody raised against RPL27

RPL27 Rabbit pAb

A5936-100ul 100 ul
EUR 308

RPL27 Rabbit pAb

A5936-200ul 200 ul
EUR 459

RPL27 Rabbit pAb

A5936-20ul 20 ul Ask for price

RPL27 Rabbit pAb

A5936-50ul 50 ul Ask for price

RPL27 Polyclonal Antibody

A52708 100 µg
EUR 570.55
Description: fast delivery possible

RPL27 Rabbit pAb

A13044-100ul 100 ul
EUR 308

RPL27 Rabbit pAb

A13044-200ul 200 ul
EUR 459

RPL27 Rabbit pAb

A13044-20ul 20 ul
EUR 183

RPL27 Rabbit pAb

A13044-50ul 50 ul
EUR 223

RPL27 Blocking Peptide

33R-8904 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL27 antibody, catalog no. 70R-2387

RPL27 antibody (HRP)

60R-1439 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (HRP)

RPL27 antibody (FITC)

60R-1440 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (FITC)

RPL27 antibody (biotin)

60R-1441 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (biotin)

RPL27 Blocking Peptide

DF9129-BP 1mg
EUR 195

Anti-RPL27 antibody

PAab07426 100 ug
EUR 386

Anti-RPL27 antibody

STJ27732 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL27 antibody

STJ115011 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rat RPL27 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002583 96 Tests
EUR 689


ELI-42598d 96 Tests
EUR 928

Human RPL27 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL27 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL27 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL27 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL27 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL27 Recombinant Protein (Human)

RP026929 100 ug Ask for price

RPL27 Recombinant Protein (Human)

RP026932 100 ug Ask for price

RPL27 Recombinant Protein (Rat)

RP226649 100 ug Ask for price

RPL27 Recombinant Protein (Mouse)

RP169013 100 ug Ask for price

Ribosomal Protein L27 (RPL27) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

abx122993-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

abx237426-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL27 Polyclonal Antibody, Biotin Conjugated

A52705 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL27 Polyclonal Antibody, FITC Conjugated

A52706 100 µg
EUR 570.55
Description: fast delivery possible

RPL27 Polyclonal Antibody, HRP Conjugated

A52707 100 µg
EUR 570.55
Description: reagents widely cited

RPL27 ORF Vector (Human) (pORF)

ORF008977 1.0 ug DNA
EUR 95

RPL27 ORF Vector (Human) (pORF)

ORF008978 1.0 ug DNA
EUR 95

Rpl27 ORF Vector (Mouse) (pORF)

ORF056339 1.0 ug DNA
EUR 506

Rpl27 ORF Vector (Rat) (pORF)

ORF075551 1.0 ug DNA
EUR 506

Ribosomal Protein L27 (RPL27) Antibody Pair

abx117454-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

60S Ribosomal Protein L27 (RPL27) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL27 sgRNA CRISPR Lentivector set (Human)

K1952401 3 x 1.0 ug
EUR 339

Rpl27 sgRNA CRISPR Lentivector set (Mouse)

K4890901 3 x 1.0 ug
EUR 339

Rpl27 sgRNA CRISPR Lentivector set (Rat)

K6935401 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L27 (RPL27) ELISA Kit

abx382911-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL27 sgRNA CRISPR Lentivector (Human) (Target 1)

K1952402 1.0 ug DNA
EUR 154

RPL27 sgRNA CRISPR Lentivector (Human) (Target 2)

K1952403 1.0 ug DNA
EUR 154

RPL27 sgRNA CRISPR Lentivector (Human) (Target 3)

K1952404 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4890902 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4890903 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4890904 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6935402 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6935403 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6935404 1.0 ug DNA
EUR 154

RPL27 Protein Vector (Human) (pPB-C-His)

PV035905 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPB-N-His)

PV035906 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPM-C-HA)

PV035907 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPM-C-His)

PV035908 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPB-C-His)

PV035909 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPB-N-His)

PV035910 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPM-C-HA)

PV035911 500 ng
EUR 329

RPL27 Protein Vector (Human) (pPM-C-His)

PV035912 500 ng
EUR 329

RPL27 Protein Vector (Rat) (pPB-C-His)

PV302202 500 ng
EUR 603

RPL27 Protein Vector (Rat) (pPB-N-His)

PV302203 500 ng
EUR 603

RPL27 Protein Vector (Rat) (pPM-C-HA)

PV302204 500 ng
EUR 603

RPL27 Protein Vector (Rat) (pPM-C-His)

PV302205 500 ng
EUR 603