PSMC5 antibody

20R-1193 100 ug
EUR 377
Description: Rabbit polyclonal PSMC5 antibody

PSMC5 Antibody

32302-100ul 100ul
EUR 252

PSMC5 antibody

10R-1411 100 ug
EUR 512
Description: Mouse monoclonal PSMC5 antibody

PSMC5 Antibody

DF6445 200ul
EUR 304
Description: PSMC5 Antibody detects endogenous levels of total PSMC5.

PSMC5 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 Antibody

CSB-PA018895KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC5 Antibody

ABD6445 100 ug
EUR 438


PVT18144 2 ug
EUR 231

PSMC5 Rabbit pAb

A1538-100ul 100 ul
EUR 308

PSMC5 Rabbit pAb

A1538-200ul 200 ul
EUR 459

PSMC5 Rabbit pAb

A1538-20ul 20 ul
EUR 183

PSMC5 Rabbit pAb

A1538-50ul 50 ul
EUR 223

PSMC5 Rabbit pAb

A13537-100ul 100 ul
EUR 308

PSMC5 Rabbit pAb

A13537-200ul 200 ul
EUR 459

PSMC5 Rabbit pAb

A13537-20ul 20 ul
EUR 183

PSMC5 Rabbit pAb

A13537-50ul 50 ul
EUR 223

PSMC5 Blocking Peptide

33R-1153 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOSC2 antibody, catalog no. 70R-4705

PSMC5 Blocking Peptide

DF6445-BP 1mg
EUR 195

PSMC5 Conjugated Antibody

C32302 100ul
EUR 397

PSMC5 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 cloning plasmid

CSB-CL018895HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1221
  • Sequence: atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctat
  • Show more
Description: A cloning plasmid for the PSMC5 gene.

Anti-PSMC5 antibody

STJ25184 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Anti-PSMC5 antibody

STJ115498 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Mouse PSMC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC5 Recombinant Protein (Human)

RP024967 100 ug Ask for price

PSMC5 Recombinant Protein (Mouse)

RP165308 100 ug Ask for price

PSMC5 Recombinant Protein (Rat)

RP222650 100 ug Ask for price

Psmc5 ORF Vector (Rat) (pORF)

ORF074218 1.0 ug DNA
EUR 506

PSMC5 ORF Vector (Human) (pORF)

ORF008323 1.0 ug DNA
EUR 95

Psmc5 ORF Vector (Mouse) (pORF)

ORF055104 1.0 ug DNA
EUR 506

Polyclonal PSMC5 antibody - C-terminal region

APR00730G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC5 - C-terminal region. This antibody is tested and proven to work in the following applications:

Psmc5 sgRNA CRISPR Lentivector set (Rat)

K7056601 3 x 1.0 ug
EUR 339

Psmc5 sgRNA CRISPR Lentivector set (Mouse)

K4647401 3 x 1.0 ug
EUR 339

PSMC5 sgRNA CRISPR Lentivector set (Human)

K1741401 3 x 1.0 ug
EUR 339

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody

abx117106-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody

abx122053-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

26S Proteasome Regulatory Subunit 8 (PSMC5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Psmc5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7056602 1.0 ug DNA
EUR 154

Psmc5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7056603 1.0 ug DNA
EUR 154

Psmc5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7056604 1.0 ug DNA
EUR 154

Psmc5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4647402 1.0 ug DNA
EUR 154

Psmc5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4647403 1.0 ug DNA
EUR 154