PSCA

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit

DLR-PSCA-Hu-96T 96T
EUR 673
  • Should the Human Prostate Stem Cell Antigen (PSCA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prostate Stem Cell Antigen (PSCA) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit

RD-PSCA-Hu-48Tests 48 Tests
EUR 521

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit

RD-PSCA-Hu-96Tests 96 Tests
EUR 723

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit

RDR-PSCA-Hu-48Tests 48 Tests
EUR 544

Human Prostate Stem Cell Antigen (PSCA) ELISA Kit

RDR-PSCA-Hu-96Tests 96 Tests
EUR 756

PSCA antibody

70R-50580 100 ul
EUR 244
Description: Purified Polyclonal PSCA antibody

PSCA antibody

70R-30729 100 ug
EUR 327
Description: Rabbit polyclonal PSCA antibody

PSCA antibody

70R-8532 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PSCA antibody

PSCA protein

30R-3214S 50 ug
EUR 259
Description: Purified recombinant PSCA protein

PSCA Antibody

32922-100ul 100ul
EUR 252

PSCA antibody

70R-19568 50 ul
EUR 435
Description: Rabbit polyclonal PSCA antibody

PSCA Antibody

1-CSB-PA003863
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PSCA Antibody

1-CSB-PA587709
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PSCA Antibody

CSB-PA052817-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSCA Antibody

CSB-PA052817-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSCA Antibody

1-CSB-PA058956
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

PSCA Antibody

1-CSB-PA018840ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSCA Antibody

1-CSB-PA018840GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSCA. Recognizes PSCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-PSCA

YF-PA15514 50 ug
EUR 363
Description: Mouse polyclonal to PSCA

anti-PSCA

YF-PA15515 100 ug
EUR 403
Description: Rabbit polyclonal to PSCA

anti-PSCA

YF-PA25029 50 ul
EUR 334
Description: Mouse polyclonal to PSCA

PSCA Conjugated Antibody

C32922 100ul
EUR 397

PSCA cloning plasmid

CSB-CL018840HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atgaaggctgtgctgcttgccctgttgatggcaggcttggccctgcagccaggcactgccctgctgtgctactcctgcaaagcccaggtgagcaacgaggactgcctgcaggtggagaactgcacccagctgggggagcagtgctggaccgcgcgcatccgcgcagttggcctcct
  • Show more
Description: A cloning plasmid for the PSCA gene.

PSCA Polyclonal Antibody

ES3268-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSCA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSCA Polyclonal Antibody

ES3268-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSCA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- PSCA antibody

FNab06848 100µg
EUR 585
  • Immunogen: prostate stem cell antigen
  • Uniprot ID: O43653
  • Research Area: Stem Cells, Cancer
Description: Antibody raised against PSCA

PSCA Polyclonal Antibody

ABP52269-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

PSCA Polyclonal Antibody

ABP52269-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

PSCA Polyclonal Antibody

ABP52269-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of PSCA from Human, Mouse. This PSCA antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSCA at AA range: 10-90

PSCA Blocking Peptide

20-abx063455
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-PSCA Antibody

A02657 1ml
EUR 456
Description: Rabbit Polyclonal PSCA Antibody. Validated in IHC and tested in Human.

PSCA Rabbit pAb

A5614-100ul 100 ul
EUR 308

PSCA Rabbit pAb

A5614-200ul 200 ul
EUR 459

PSCA Rabbit pAb

A5614-20ul 20 ul
EUR 183

PSCA Rabbit pAb

A5614-50ul 50 ul
EUR 223

Anti-PSCA Antibody

A1611-100
EUR 370

PSCA Blocking Peptide

33R-9358 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSCA antibody, catalog no. 70R-8532

PSCA Polyclonal Antibody

41364-100ul 100ul
EUR 252

PSCA Polyclonal Antibody

41364-50ul 50ul
EUR 187

Anti-PSCA Antibody

PB9351 100ug/vial
EUR 294

Anti-PSCA antibody

PAab06848 100 ug
EUR 412

pOTB7-PSCA Plasmid

PVT15918 2 ug
EUR 325

pOTB7-PSCA Plasmid

PVT15937 2 ug
EUR 325

Anti-PSCA antibody

STJ95242 200 µl
EUR 197
Description: Rabbit polyclonal to PSCA.

Anti-PSCA antibody

STJ11100914 100 µl
EUR 277
Description: This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants.

Anti-PSCA (1E1)

YF-MA16262 100 ug
EUR 363
Description: Mouse monoclonal to PSCA

Anti-PSCA (5C2)

YF-MA11038 100 ug
EUR 363
Description: Mouse monoclonal to PSCA

Polyclonal PSCA Antibody (Center)

AMM08670G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSCA (Center). This antibody is tested and proven to work in the following applications:

Human PSCA ELISA Kit

ELA-E8693h 96 Tests
EUR 824

PSCA ELISA KIT|Human

EF006435 96 Tests
EUR 689

PSCA Recombinant Protein (Human)

RP024829 100 ug Ask for price

PSCA Recombinant Protein (Rat)

RP222539 100 ug Ask for price

PSCA Recombinant Protein (Mouse)

RP165155 100 ug Ask for price

PSCA ORF Vector (Human) (pORF)

ORF008277 1.0 ug DNA
EUR 95

Psca ORF Vector (Rat) (pORF)

ORF074181 1.0 ug DNA
EUR 506