NFYA

NFYA Antibody

ABD3125 100 ug
EUR 438.00

NFYA Antibody

33722-100ul 100ul
EUR 252.00

NFYA Antibody

33722-50ul 50ul
EUR 187.00

NFYA Antibody

DF3125 200ul
EUR 304.00
Description: NFYA Antibody detects endogenous levels of total NFYA.

NFYA Antibody

1-CSB-PA015773GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NFYA Antibody

1-CSB-PA003424
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

NFYA antibody

70R-50129 100 ul
EUR 244.00
Description: Purified Polyclonal NFYA antibody

NFYA antibody

70R-31644 100 ug
EUR 327.00
Description: Rabbit polyclonal NFYA antibody

NFYA antibody

70R-18866 50 ul
EUR 435.00
Description: Rabbit polyclonal NFYA antibody

NFYA Antibody

CSB-PA288741-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFYA Antibody

CSB-PA288741-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFYA siRNA

20-abx903550
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFYA siRNA

20-abx925850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFYA siRNA

20-abx925851
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pUC19-NFYA

PVT17593 2 ug
EUR 231.00

anti-NFYA

YF-PA24243 50 ul
EUR 334.00
Description: Mouse polyclonal to NFYA

NFYA Rabbit pAb

A1998-100ul 100 ul
EUR 308.00

NFYA Rabbit pAb

A1998-200ul 200 ul
EUR 459.00

NFYA Rabbit pAb

A1998-20ul 20 ul
EUR 183.00

NFYA Rabbit pAb

A1998-50ul 50 ul
EUR 223.00

NFYA Polyclonal Antibody

E-AB-32219-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly cons
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat NFYA for WB,IHC-p,IF,ELISA applications.

NFYA Polyclonal Antibody

E-AB-32219-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly cons
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat NFYA for WB,IHC-p,IF,ELISA applications.

NFYA Polyclonal Antibody

E-AB-32219-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly cons
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat NFYA for WB,IHC-p,IF,ELISA applications.

NFYA Blocking Peptide

DF3125-BP 1mg
EUR 195.00

NFYA Blocking Peptide

20-abx063004
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NFYA Conjugated Antibody

C33722 100ul
EUR 397.00

NFYA cloning plasmid

CSB-CL015773HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atggagcagtatacagcaaacagcaatagttcgacagagcagattgttgtccaggcaggacagattcagcagcaggtccaagggcagccattaatggtgcaggtcagtggaggccagctaatcacatcaactggccaacccatcatggtccaggctgtccctggtgggcaaggtca
  • Show more
Description: A cloning plasmid for the NFYA gene.

anti- NFYA antibody

FNab05716 100µg
EUR 505.25
  • Immunogen: nuclear transcription factor Y, alpha
  • Uniprot ID: P23511
  • Gene ID: 4800
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against NFYA

Anti-NFYA antibody

PAab05716 100 ug
EUR 355.00

pECMV-NFYA-3

PVT17624 2 ug
EUR 258.00

Anti-NFYA antibody

STJ111124 100 µl
EUR 277.00
Description: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms.

Rat NFYA shRNA Plasmid

20-abx985549
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NFYA ELISA KIT

ELI-13647h 96 Tests
EUR 824.00

Bovine NFYA ELISA KIT

ELI-22188b 96 Tests
EUR 928.00

NFYA ELISA KIT|Human

EF001216 96 Tests
EUR 689.00

Human NFYA shRNA Plasmid

20-abx953186
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFYA shRNA Plasmid

20-abx971739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Nfya ELISA KIT

ELI-44625m 96 Tests
EUR 865.00

NFYA Recombinant Protein (Rat)

RP213854 100 ug Ask for price

NFYA Recombinant Protein (Mouse)

RP153989 100 ug Ask for price

NFYA Recombinant Protein (Mouse)

RP153992 100 ug Ask for price

NFYA Recombinant Protein (Human)

RP021172 100 ug Ask for price

NFYA ORF Vector (Human) (pORF)

ORF007058 1.0 ug DNA
EUR 95.00

Nfya ORF Vector (Mouse) (pORF)

ORF051331 1.0 ug DNA
EUR 506.00

Nfya ORF Vector (Mouse) (pORF)

ORF051332 1.0 ug DNA
EUR 506.00

Nfya ORF Vector (Rat) (pORF)

ORF071286 1.0 ug DNA
EUR 506.00

NFYA sgRNA CRISPR Lentivector set (Human)

K1423901 3 x 1.0 ug
EUR 339.00

Nfya sgRNA CRISPR Lentivector set (Rat)

K6930201 3 x 1.0 ug
EUR 339.00

Nfya sgRNA CRISPR Lentivector set (Mouse)

K3857701 3 x 1.0 ug
EUR 339.00

NFYA sgRNA CRISPR Lentivector (Human) (Target 1)

K1423902 1.0 ug DNA
EUR 154.00

NFYA sgRNA CRISPR Lentivector (Human) (Target 2)

K1423903 1.0 ug DNA
EUR 154.00

NFYA sgRNA CRISPR Lentivector (Human) (Target 3)

K1423904 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Rat) (Target 1)

K6930202 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Rat) (Target 2)

K6930203 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Rat) (Target 3)

K6930204 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3857702 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3857703 1.0 ug DNA
EUR 154.00

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3857704 1.0 ug DNA
EUR 154.00

NFYA Protein Vector (Human) (pPB-C-His)

PV028229 500 ng
EUR 329.00

NFYA Protein Vector (Human) (pPB-N-His)

PV028230 500 ng
EUR 329.00

NFYA Protein Vector (Human) (pPM-C-HA)

PV028231 500 ng
EUR 329.00

NFYA Protein Vector (Human) (pPM-C-His)

PV028232 500 ng
EUR 329.00

NFYA Protein Vector (Rat) (pPB-C-His)

PV285142 500 ng
EUR 603.00

NFYA Protein Vector (Rat) (pPB-N-His)

PV285143 500 ng
EUR 603.00

NFYA Protein Vector (Rat) (pPM-C-HA)

PV285144 500 ng
EUR 603.00

NFYA Protein Vector (Rat) (pPM-C-His)

PV285145 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPB-C-His)

PV205322 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPB-N-His)

PV205323 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPM-C-HA)

PV205324 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPM-C-His)

PV205325 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPB-C-His)

PV205326 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPB-N-His)

PV205327 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPM-C-HA)

PV205328 500 ng
EUR 603.00

NFYA Protein Vector (Mouse) (pPM-C-His)

PV205329 500 ng
EUR 603.00

Nfya 3'UTR GFP Stable Cell Line

TU164054 1.0 ml Ask for price

Nfya 3'UTR GFP Stable Cell Line

TU263948 1.0 ml Ask for price

Nfya 3'UTR Luciferase Stable Cell Line

TU213948 1.0 ml Ask for price

NFYA 3'UTR GFP Stable Cell Line

TU065648 1.0 ml
EUR 1521.00

NFYA 3'UTR Luciferase Stable Cell Line

TU015648 1.0 ml
EUR 1521.00

Nfya 3'UTR Luciferase Stable Cell Line

TU114054 1.0 ml Ask for price

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

20-abx126251
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

abx235716-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

20-abx013436
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

20-abx008932
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

abx332688-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) Antibody

20-abx329378
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NFYA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664609 1.0 ug DNA
EUR 682.00

NFYA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664613 1.0 ug DNA
EUR 682.00

NFYA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664614 1.0 ug DNA
EUR 682.00

Recombinant Human Nuclear Transcription Factor Y Subunit α/NFYA

CH12-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Human Nuclear Transcription Factor Y Subunit α/NFYA

CH12-1mg 1mg
EUR 2486.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Human Nuclear Transcription Factor Y Subunit α/NFYA

CH12-500ug 500ug
EUR 1755.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Recombinant Human Nuclear Transcription Factor Y Subunit α/NFYA

CH12-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH 7.4.

Nuclear Transcription Factor Y Subunit Alpha (NFYA) ELISA Kit

abx596523-96tests 96 tests
EUR 723.00
  • Shipped within 1-2 weeks.

NFYA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1423905 3 x 1.0 ug
EUR 376.00