LMNA

Human Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Hu-96T 96T
EUR 673.00
  • Should the Human Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-48T 48T
EUR 527.00
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-96T 96T
EUR 688.00
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Human Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Lamin A/C (LMNA)

Human Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Lamin A/C (LMNA)

Human Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Lamin A/C (LMNA)

Mouse Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lamin A/C (LMNA)

Mouse Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lamin A/C (LMNA)

Mouse Lamin A/C (LMNA) ELISA Kit

DL-LMNA-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lamin A/C (LMNA)

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-48Tests 48 Tests
EUR 521.00

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-96Tests 96 Tests
EUR 723.00

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-48Tests 48 Tests
EUR 533.00

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-96Tests 96 Tests
EUR 740.00

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-48Tests 48 Tests
EUR 544.00

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-96Tests 96 Tests
EUR 756.00

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-48Tests 48 Tests
EUR 557.00

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-96Tests 96 Tests
EUR 774.00

LMNA Antibody

ABD6052 100 ug
EUR 438.00

LMNA Antibody

32042-100ul 100ul
EUR 252.00

LMNA siRNA

20-abx903004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA Antibody

1-CSB-PA003130
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

LMNA Antibody

1-CSB-PA003131
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

LMNA Antibody

1-CSB-PA193640
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

LMNA Antibody

1-CSB-PA144058
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

LMNA Antibody

1-CSB-PA013003GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

LMNA Antibody

1-CSB-PA013003HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

LMNA Antibody

DF6052 200ul
EUR 304.00
Description: LMNA Antibody detects endogenous levels of total LMNA.

pOTB7-LMNA

PVT18459 2 ug
EUR 231.00

LMNA Conjugated Antibody

C32042 100ul
EUR 397.00

LMNA cloning plasmid

CSB-CL013003HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

LMNA cloning plasmid

CSB-CL013003HU2-10ug 10ug
EUR 668.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1995
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

LMNA Polyclonal Antibody

E-AB-40252-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity Purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear memb
  • Show more
Description: Rabbit antibody against Human LMNA for WB applications.

LMNA Polyclonal Antibody

E-AB-40252-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity Purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear memb
  • Show more
Description: Rabbit antibody against Human LMNA for WB applications.

LMNA Polyclonal Antibody

E-AB-40252-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
  • Purified by: Affinity Purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear memb
  • Show more
Description: Rabbit antibody against Human LMNA for WB applications.

LMNA Polyclonal Antibody

E-AB-70326-120uL 120uL
EUR 253.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inn
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC applications.

LMNA Polyclonal Antibody

E-AB-70326-200uL 200uL
EUR 400.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inn
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC applications.

LMNA Polyclonal Antibody

E-AB-70326-60uL 60uL
EUR 182.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inn
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC applications.

LMNA Polyclonal Antibody

E-AB-31899-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,IF,ELISA applications.

LMNA Polyclonal Antibody

E-AB-31899-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,IF,ELISA applications.

LMNA Polyclonal Antibody

E-AB-31899-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,IF,ELISA applications.

LMNA Polyclonal Antibody

E-AB-31900-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,ELISA applications.

LMNA Polyclonal Antibody

E-AB-31900-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,ELISA applications.

LMNA Polyclonal Antibody

E-AB-31900-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inne
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC-p,ELISA applications.

LMNA Polyclonal Antibody

E-AB-10433-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear mem
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC,ELISA applications.

LMNA Polyclonal Antibody

E-AB-10433-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear mem
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC,ELISA applications.

LMNA Polyclonal Antibody

E-AB-10433-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear mem
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat LMNA for WB,IHC,ELISA applications.

LMNA Blocking Peptide

DF6052-BP 1mg
EUR 195.00

anti-LMNA (4E7)

LF-MA30610 100 ul
EUR 527.00
Description: Mouse Monoclonal to LMNA

Recombinant human LMNA

P1083 100ug Ask for price
  • Uniprot ID: P02545-2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LMNA

Anti-LMNA antibody

STJ110962 100 µl
EUR 277.00
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Anti-LMNA antibody

STJ140138 150 µg
EUR 408.00
Description: Goat polyclonal to LMNA (Lamin A/C) - nucleus marker. The Lamin family of proteins make up the matrix of proteins located next to the inner nuclear membrane. During mitosis, the lamina matrix is reversibly disassembled as the Lamin proteins are phosphorylated. These proteins are thought to be involved in chromatin structure, nuclear stability and gene expression.

Anti-LMNA antibody

STJ24412 100 µl
EUR 277.00
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Lamin A (LMNA) Antibody

20-abx000634
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx015912-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Polyclonal LMNA Antibody (Center)

APR04303G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LMNA (Center). This antibody is tested and proven to work in the following applications:

Rat LMNA shRNA Plasmid

20-abx986027
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Lamin A (LMNA) Antibody

20-abx119039
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx125051
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx126963
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx413067-01mg 0.1 mg
EUR 634.00
  • Shipped within 1 week.

LMNA ELISA KIT|Human

EF001125 96 Tests
EUR 689.00

Human LMNA shRNA Plasmid

20-abx952708
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LMNA shRNA Plasmid

20-abx971331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cleaved-LMNA (N231) Antibody

1-CSB-PA009843
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-LMNA (N231). Recognizes Cleaved-LMNA (N231) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Phospho-LMNA (S22) Antibody

1-CSB-PA009844
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-LMNA (S22). Recognizes Phospho-LMNA (S22) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Phospho-LMNA (S392) Antibody

1-CSB-PA009845
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-LMNA (S392). Recognizes Phospho-LMNA (S392) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Cleaved-LMNA (D230) Antibody

1-CSB-PA000047
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-LMNA (D230). Recognizes Cleaved-LMNA (D230) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

LMNA Antibody, HRP conjugated

1-CSB-PA013003HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LMNA Antibody, FITC conjugated

1-CSB-PA013003HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LMNA Antibody, Biotin conjugated

1-CSB-PA013003HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LMNA Recombinant Protein (Mouse)

RP147701 100 ug Ask for price

LMNA Recombinant Protein (Mouse)

RP147704 100 ug Ask for price

LMNA Recombinant Protein (Mouse)

RP147707 100 ug Ask for price

LMNA Recombinant Protein (Human)

RP017893 100 ug Ask for price

LMNA Recombinant Protein (Human)

RP017896 100 ug Ask for price

LMNA Recombinant Protein (Rat)

RP208334 100 ug Ask for price

Lamin A/C (LMNA) Antibody

20-abx009031
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx009032
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx009033
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328850
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx329327
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328255
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx328386
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-LMNA-S22 Rabbit pAb

AP0777-100ul 100 ul
EUR 384.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-200ul 200 ul
EUR 554.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-20ul 20 ul
EUR 183.00

Phospho-LMNA-S22 Rabbit pAb

AP0777-50ul 50 ul
EUR 265.00

Monoclonal LMNA Antibody, Clone: 4E7

AMM02857G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human LMNA. The antibodies are raised in Mouse and are from clone 4E7. This antibody is applicable in WB and IHC, E

Lamin A/C (LMNA) Antibody

20-abx129142
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lamin A/C (LMNA) Antibody

20-abx113432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lamin A/C (LMNA) Antibody

20-abx132239
  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.