l chat gh

Human Choline Acetyltransferase (ChAT) ELISA Kit
DLR-ChAT-Hu-96T	DL Develop	96T	EUR 647
Should the Human Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
DLR-ChAT-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
DLR-ChAT-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit
DLR-ChAT-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit
DLR-ChAT-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Choline Acetyltransferase (ChAT) ELISA Kit
RD-ChAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Choline Acetyltransferase (ChAT) ELISA Kit
RDR-ChAT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Bovine Growth Hormone (GH) ELISA Kit
DLR-GH-b-48T	DL Develop	48T	EUR 547
Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit
DLR-GH-b-96T	DL Develop	96T	EUR 715
Should the Bovine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Growth Hormone (GH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit
DLR-GH-c-48T	DL Develop	48T	EUR 527
Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Canine Growth Hormone (GH) ELISA Kit
DLR-GH-c-96T	DL Develop	96T	EUR 688
Should the Canine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit
DLR-GH-Ch-48T	DL Develop	48T	EUR 508
Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Chicken Growth Hormone (GH) ELISA Kit
DLR-GH-Ch-96T	DL Develop	96T	EUR 661
Should the Chicken Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit
DLR-GH-Eq-48T	DL Develop	48T	EUR 556
Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Equine Growth Hormone (GH) ELISA Kit
DLR-GH-Eq-96T	DL Develop	96T	EUR 728
Should the Equine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Equine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Human Growth Hormone (GH) ELISA Kit
DLR-GH-Hu-48T	DL Develop	48T	EUR 381
Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Growth Hormone (GH) ELISA Kit
DLR-GH-Hu-96T	DL Develop	96T	EUR 487
Should the Human Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit
DLR-GH-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Growth Hormone (GH) ELISA Kit
DLR-GH-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Growth Hormone (GH) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit
DLR-GH-p-48T	DL Develop	48T	EUR 547
Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Porcine Growth Hormone (GH) ELISA Kit
DLR-GH-p-96T	DL Develop	96T	EUR 715
Should the Porcine Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit
DLR-GH-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Rat Growth Hormone (GH) ELISA Kit
DLR-GH-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Growth Hormone (GH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Growth Hormone (GH) in samples from serum, plasma or other biological fluids.

Bovine Growth Hormone (GH) ELISA Kit
RD-GH-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine Growth Hormone (GH) ELISA Kit
RD-GH-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Canine Growth Hormone (GH) ELISA Kit
RD-GH-c-48Tests	Reddot Biotech	48 Tests	EUR 533

Canine Growth Hormone (GH) ELISA Kit
RD-GH-c-96Tests	Reddot Biotech	96 Tests	EUR 740

Chicken Growth Hormone (GH) ELISA Kit
RD-GH-Ch-48Tests	Reddot Biotech	48 Tests	EUR 511

Chicken Growth Hormone (GH) ELISA Kit
RD-GH-Ch-96Tests	Reddot Biotech	96 Tests	EUR 709

Equine Growth Hormone (GH) ELISA Kit
RD-GH-Eq-48Tests	Reddot Biotech	48 Tests	EUR 566

Equine Growth Hormone (GH) ELISA Kit
RD-GH-Eq-96Tests	Reddot Biotech	96 Tests	EUR 787

Human Growth Hormone (GH) ELISA Kit
RD-GH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 368

Human Growth Hormone (GH) ELISA Kit
RD-GH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 504

Mouse Growth Hormone (GH) ELISA Kit
RD-GH-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Growth Hormone (GH) ELISA Kit
RD-GH-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine Growth Hormone (GH) ELISA Kit
RD-GH-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine Growth Hormone (GH) ELISA Kit
RD-GH-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat Growth Hormone (GH) ELISA Kit
RD-GH-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Growth Hormone (GH) ELISA Kit
RD-GH-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Bovine Growth Hormone (GH) ELISA Kit
RDR-GH-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Growth Hormone (GH) ELISA Kit
RDR-GH-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Canine Growth Hormone (GH) ELISA Kit
RDR-GH-c-48Tests	Reddot Biotech	48 Tests	EUR 557

Canine Growth Hormone (GH) ELISA Kit
RDR-GH-c-96Tests	Reddot Biotech	96 Tests	EUR 774

Chicken Growth Hormone (GH) ELISA Kit
RDR-GH-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken Growth Hormone (GH) ELISA Kit
RDR-GH-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Equine Growth Hormone (GH) ELISA Kit
RDR-GH-Eq-48Tests	Reddot Biotech	48 Tests	EUR 591

Equine Growth Hormone (GH) ELISA Kit
RDR-GH-Eq-96Tests	Reddot Biotech	96 Tests	EUR 823

Human Growth Hormone (GH) ELISA Kit
RDR-GH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 384

Human Growth Hormone (GH) ELISA Kit
RDR-GH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 527

Mouse Growth Hormone (GH) ELISA Kit
RDR-GH-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Growth Hormone (GH) ELISA Kit
RDR-GH-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine Growth Hormone (GH) ELISA Kit
RDR-GH-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine Growth Hormone (GH) ELISA Kit
RDR-GH-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat Growth Hormone (GH) ELISA Kit
RDR-GH-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Growth Hormone (GH) ELISA Kit
RDR-GH-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

ChAT
CH23000	Neuromics	100 ul	EUR 179

ChAT
MO20019	Neuromics	100 ul	EUR 278

Chat/ Rat Chat ELISA Kit
ELI-04655r	Lifescience Market	96 Tests	EUR 886

CHAT siRNA
20-abx911641	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHAT antibody
70R-49541	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal CHAT antibody

CHAT Antibody
ABD6964	Lifescience Market	100 ug	EUR 438

CHAT Antibody
32673-100ul	SAB	100ul	EUR 252

CHAT antibody
20R-2847	Fitzgerald	100 ul	EUR 349
Description: Rabbit polyclonal CHAT antibody

CHAT antibody
70R-14948	Fitzgerald	100 ul	EUR 392
Description: Goat polyclonal CHAT antibody

CHAT antibody
70R-10534	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CHAT antibody

ChAT antibody
70R-10625	Fitzgerald	1 ml	EUR 693
Description: Affinity purified Chicken polyclonal ChAT antibody

CHAT antibody
70R-16378	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CHAT antibody

CHAT Antibody
DF6964	Affbiotech	200ul	EUR 304
Description: CHAT Antibody detects endogenous levels of total CHAT.

CHAT Antibody
1-CSB-PA001637	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHAT Antibody
1-CSB-PA005314GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHAT Antibody
1-CSB-PA005314LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Cytomegalovirus gH (CMV gH) Antibody
abx415688-01mg	Abbexa	0.1 mg	EUR 648
Shipped within 1 week.

CHAT Conjugated Antibody
C32673	SAB	100ul	EUR 397

CHAT cloning plasmid
CSB-CL005314HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1893 Sequence: atgacagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg Show more
Description: A cloning plasmid for the CHAT gene.

CHAT cloning plasmid
CSB-CL005314HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1893 Sequence: atggcagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg Show more
Description: A cloning plasmid for the CHAT gene.

anti- CHAT antibody
FNab01631	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: choline acetyltransferase Uniprot ID: P28329 Gene ID: 1103 Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

anti- CHAT antibody
FNab01632	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:50-1:200 IF: 1:50-1:500 Immunogen: choline acetyltransferase Uniprot ID: P28329 Gene ID: 1103 Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

CHAT Blocking Peptide
20-abx062416	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

CHAT Rabbit pAb
A12420-100ul	Abclonal	100 ul	EUR 308

CHAT Rabbit pAb
A12420-200ul	Abclonal	200 ul	EUR 459

CHAT Rabbit pAb
A12420-20ul	Abclonal	20 ul	EUR 183

CHAT Rabbit pAb
A12420-50ul	Abclonal	50 ul	EUR 223

CHAT Rabbit pAb
A13244-100ul	Abclonal	100 ul	EUR 308

CHAT Rabbit pAb
A13244-200ul	Abclonal	200 ul	EUR 459

CHAT Rabbit pAb
A13244-20ul	Abclonal	20 ul	EUR 183