Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

DLR-HSPA8-Hu-96T 96T
EUR 570
  • Should the Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock 70kDa Protein 8 (HSPA8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

DLR-HSPA8-Mu-48T 48T
EUR 450
  • Should the Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 70kDa Protein 8 (HSPA8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

DLR-HSPA8-Mu-96T 96T
EUR 582
  • Should the Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heat Shock 70kDa Protein 8 (HSPA8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

DLR-HSPA8-Ra-48T 48T
EUR 467
  • Should the Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 70kDa Protein 8 (HSPA8) in samples from serum, plasma or other biological fluids.

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

DLR-HSPA8-Ra-96T 96T
EUR 605
  • Should the Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heat Shock 70kDa Protein 8 (HSPA8) in samples from serum, plasma or other biological fluids.

Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Hu-48Tests 48 Tests
EUR 436

Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Hu-96Tests 96 Tests
EUR 601

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Mu-48Tests 48 Tests
EUR 446

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Mu-96Tests 96 Tests
EUR 615

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Ra-48Tests 48 Tests
EUR 465

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RD-HSPA8-Ra-96Tests 96 Tests
EUR 643

Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Hu-48Tests 48 Tests
EUR 455

Human Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Hu-96Tests 96 Tests
EUR 629

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Mu-48Tests 48 Tests
EUR 465

Mouse Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Mu-96Tests 96 Tests
EUR 643

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Ra-48Tests 48 Tests
EUR 486

Rat Heat Shock 70kDa Protein 8 (HSPA8) ELISA Kit

RDR-HSPA8-Ra-96Tests 96 Tests
EUR 672


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HSPA8 antibody

70R-4109 50 ug
EUR 467
Description: Rabbit polyclonal HSPA8 antibody raised against the N terminal of HSPA8

HSPA8 antibody

70R-2851 50 ug
EUR 467
Description: Rabbit polyclonal HSPA8 antibody raised against the N terminal of HSPA8

HSPA8 Antibody

ABD13120 100 ug
EUR 438

HSPA8 Antibody

ABD4704 100 ug
EUR 438

HSPA8 Antibody

ABD6957 100 ug
EUR 438

HSPA8 Antibody

35220-100ul 100ul
EUR 252

HSPA8 Antibody

35220-50ul 50ul
EUR 187

HSPA8 antibody

10R-10297 100 ug
EUR 435
Description: Mouse monoclonal HSPA8 antibody

HSPA8 Antibody

32668-100ul 100ul
EUR 252

HSPA8 antibody

70R-17842 50 ul
EUR 435
Description: Rabbit polyclonal HSPA8 antibody

HSPA8 Antibody

DF4704 200ul
EUR 304
Description: HSPA8 Antibody detects endogenous levels of total HSPA8.

HSPA8 Antibody

DF6957 200ul
EUR 304
Description: HSPA8 Antibody detects endogenous levels of total HSPA8.

HSPA8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HSPA8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HSPA8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HSPA8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

HSPA8 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HSPA8 Antibody

CSB-PA162061-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HSPA8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

HSPA8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA8. Recognizes HSPA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


PVT12693 2 ug
EUR 391

HSPA8 Conjugated Antibody

C32668 100ul
EUR 397

HSPA8 cloning plasmid

CSB-CL010829HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1941
  • Sequence: atgtccaagggacctgcagttggtattgatcttggcaccacctactcttgtgtgggtgttttccagcacggaaaagtcgagataattgccaatgatcagggaaaccgaaccactccaagctatgtcgcctttacggacactgaacggttgatcggtgatgccgcaaagaatcaag
  • Show more
Description: A cloning plasmid for the HSPA8 gene.

HSPA8 cloning plasmid

CSB-CL010829HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1941
  • Sequence: atgtccaagggacctgcagttggtattgatcttggcaccacctactcttgtgtgggtgttttccagcacggaaaagtcgagataattgccaatgatcagggaaaccgaaccactccaagctatgtcgcctttacggacactgaacggttgatcggtgatgccgcaaagaatcaag
  • Show more
Description: A cloning plasmid for the HSPA8 gene.

HSPA8 cloning plasmid

CSB-CL010829HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1761
  • Sequence: atgaaccccaccaacacagtttttgatgccaaacgtctgattggacgcagatttgatgatgctgttgtccagtctgatatgaaacattggccctttatggtggtgaatgatgctggcaggcccaaggtccaagtagaatacaagggagagaccaaaagcttctatccagaggagg
  • Show more
Description: A cloning plasmid for the HSPA8 gene.

HSPA8 Rabbit pAb

A14001-100ul 100 ul
EUR 308

HSPA8 Rabbit pAb

A14001-200ul 200 ul
EUR 459

HSPA8 Rabbit pAb

A14001-20ul 20 ul
EUR 183

HSPA8 Rabbit pAb

A14001-50ul 50 ul
EUR 223

HSPA8 Blocking Peptide

33R-6448 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPA8 antibody, catalog no. 70R-2851

HSPA8 Blocking Peptide

33R-9900 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPA8 antibody, catalog no. 70R-4109

HSPA8 Blocking Peptide

DF4704-BP 1mg
EUR 195

HSPA8 Blocking Peptide

DF6957-BP 1mg
EUR 195


PVT13239 2 ug
EUR 391

Anti-HSPA8 antibody

STJ24099 100 µl
EUR 277
Description: This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-HSPA8 antibody

STJ115936 100 µl
EUR 277
Description: This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Rat HSPA8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E1094h 96 Tests
EUR 824


EF004197 96 Tests
EUR 689

HSPA8 (Isoform 1) Antibody

abx431340-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.