GPLD1

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DLR-GPLD1-Hu-96T 96T
EUR 673.00
  • Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DL-GPLD1-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DL-GPLD1-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DL-GPLD1-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-48Tests 48 Tests
EUR 544.00

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-96Tests 96 Tests
EUR 756.00

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-48Tests 48 Tests
EUR 521.00

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-96Tests 96 Tests
EUR 723.00

GPLD1 Antibody

ABD9750 100 ug
EUR 438.00

GPLD1 antibody

39044-100ul 100ul
EUR 252.00

GPLD1 siRNA

20-abx918384
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 siRNA

20-abx918385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 Antibody

1-CSB-PA009721LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GPLD1 Antibody

DF9750 200ul
EUR 304.00
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

anti-GPLD1

YF-PA12100 50 ul
EUR 363.00
Description: Mouse polyclonal to GPLD1

anti-GPLD1

YF-PA12101 50 ug
EUR 363.00
Description: Mouse polyclonal to GPLD1

GPLD1 Conjugated Antibody

C39044 100ul
EUR 397.00

GPLD1 Rabbit pAb

A6612-100ul 100 ul
EUR 308.00

GPLD1 Rabbit pAb

A6612-200ul 200 ul
EUR 459.00

GPLD1 Rabbit pAb

A6612-20ul 20 ul
EUR 183.00

GPLD1 Rabbit pAb

A6612-50ul 50 ul
EUR 223.00

GPLD1 cloning plasmid

CSB-CL009721HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc
  • Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Blocking Peptide

DF9750-BP 1mg
EUR 195.00

Anti-GPLD1 antibody

STJ28695 100 µl
EUR 277.00
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Rat GPLD1 shRNA Plasmid

20-abx988490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPLD1 ELISA Kit

ELA-E13691h 96 Tests
EUR 824.00

GPLD1 ELISA KIT|Human

EF005585 96 Tests
EUR 689.00

Human GPLD1 shRNA Plasmid

20-abx951887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPLD1 Antibody, HRP conjugated

1-CSB-PA009721LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPLD1 Antibody, FITC conjugated

1-CSB-PA009721LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPLD1 Antibody, Biotin conjugated

1-CSB-PA009721LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPLD1 ORF Vector (Human) (pORF)

ORF004583 1.0 ug DNA
EUR 95.00

Gpld1 ORF Vector (Mouse) (pORF)

ORF046446 1.0 ug DNA
EUR 506.00

Gpld1 ORF Vector (Rat) (pORF)

ORF067750 1.0 ug DNA
EUR 506.00

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx005070
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal GPLD1 Antibody - N-terminal region

APR01631G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPLD1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx129033
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx172649
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

GPLD1 sgRNA CRISPR Lentivector set (Human)

K0888101 3 x 1.0 ug
EUR 339.00

Gpld1 sgRNA CRISPR Lentivector set (Rat)

K7343301 3 x 1.0 ug
EUR 339.00

Gpld1 sgRNA CRISPR Lentivector set (Mouse)

K3398501 3 x 1.0 ug
EUR 339.00

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

4-RPH975Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P80108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein

20-abx168135
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0888102 1.0 ug DNA
EUR 154.00

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0888103 1.0 ug DNA
EUR 154.00

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0888104 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7343302 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7343303 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7343304 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3398502 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3398503 1.0 ug DNA
EUR 154.00

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3398504 1.0 ug DNA
EUR 154.00

GPLD1 Protein Vector (Mouse) (pPB-C-His)

PV185782 500 ng
EUR 1065.00

GPLD1 Protein Vector (Mouse) (pPB-N-His)

PV185783 500 ng
EUR 1065.00

GPLD1 Protein Vector (Mouse) (pPM-C-HA)

PV185784 500 ng
EUR 1065.00

GPLD1 Protein Vector (Mouse) (pPM-C-His)

PV185785 500 ng
EUR 1065.00

GPLD1 Protein Vector (Human) (pPB-C-His)

PV018329 500 ng
EUR 329.00

GPLD1 Protein Vector (Human) (pPB-N-His)

PV018330 500 ng
EUR 329.00

GPLD1 Protein Vector (Human) (pPM-C-HA)

PV018331 500 ng
EUR 329.00

GPLD1 Protein Vector (Human) (pPM-C-His)

PV018332 500 ng
EUR 329.00