  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAPPC9 antibody
70R-20968 50 ul
EUR 435
Description: Rabbit polyclonal TRAPPC9 antibody
TRAPPC9 Antibody
DF12489 200ul
EUR 304
Description: TRAPPC9 antibody detects endogenous levels of TRAPPC9.
TRAPPC9 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TRAPPC9 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TRAPPC9 Rabbit pAb
A15527-100ul 100 ul
EUR 308
TRAPPC9 Rabbit pAb
A15527-200ul 200 ul
EUR 459
TRAPPC9 Rabbit pAb
A15527-20ul 20 ul
EUR 183
TRAPPC9 Rabbit pAb
A15527-50ul 50 ul
EUR 223
TRAPPC9 Polyclonal Antibody
29323-100ul 100ul
EUR 252
TRAPPC9 Polyclonal Antibody
29323-50ul 50ul
EUR 187
TRAPPC9 Blocking Peptide
DF12489-BP 1mg
EUR 195
TRAPPC9 cloning plasmid
CSB-CL842741HU-10ug 10ug
EUR 877
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2739
  • Sequence: atgtcggtggagctgctgcgttctgtgaatgactttctgtggcttggagctgccctggaaggattgtgttcagcttctgtcatctatcactatcctggtggaactggtgggaagagtggagctcggaggttccagggcagcacccttcctgctgaagcagccaatagacaccggc
  • Show more
Description: A cloning plasmid for the TRAPPC9 gene.
Anti-TRAPPC9 antibody
PAab08949 100 ug
EUR 355
Anti-TRAPPC9 antibody
STJ117722 100 µl
EUR 277
Description: This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.
TRAPPC9 Polyclonal Conjugated Antibody
C29323 100ul
EUR 397
Mouse TRAPPC9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRAPPC9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-16494h 96 Tests
EUR 824
EF003802 96 Tests
EUR 689
anti- Trappc9,NIBP antibody
FNab08950 100µg
EUR 548.75
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP
anti- Trappc9,NIBP antibody
FNab08951 100µg
EUR 585
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against Trappc9,NIBP
anti- TRAPPC9,NIBP antibody
FNab08952 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9,NIBP
anti- TRAPPC9/NIBP antibody
FNab08953 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: trafficking protein particle complex 9
  • Uniprot ID: Q96Q05
  • Gene ID: 83696
  • Research Area: Signal Transduction
Description: Antibody raised against TRAPPC9/NIBP
Mouse Trappc9 ELISA KIT
ELI-36677m 96 Tests
EUR 865
ELI-51135b 96 Tests
EUR 928
TRAPPC9 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRAPPC9 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRAPPC9 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAPPC9. Recognizes TRAPPC9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-Trappc9,NIBP antibody
PAab08950 100 ug
EUR 386
Anti-Trappc9,NIBP antibody
PAab08951 100 ug
EUR 412
Anti-TRAPPC9/NIBP antibody
PAab08953 100 ug
EUR 386
Trappc9/NIBP ELISA KIT|Human
EF003803 96 Tests
EUR 689
TRAPPC9 ORF Vector (Human) (pORF)
ORF034294 1.0 ug DNA Ask for price
Trappc9 ORF Vector (Rat) (pORF)
ORF078192 1.0 ug DNA
EUR 506
Trappc9 ORF Vector (Mouse) (pORF)
ORF060313 1.0 ug DNA
EUR 506
Trappc9 ORF Vector (Mouse) (pORF)
ORF060314 1.0 ug DNA
EUR 506
Trappc9 ORF Vector (Mouse) (pORF)
ORF060315 1.0 ug DNA
EUR 506
Trappc9 ORF Vector (Mouse) (pORF)
ORF060316 1.0 ug DNA
EUR 506
Trappc9 ORF Vector (Mouse) (pORF)
ORF060317 1.0 ug DNA
EUR 506
TRAPPC9 sgRNA CRISPR Lentivector set (Human)
K2442001 3 x 1.0 ug
EUR 339
Trappc9 sgRNA CRISPR Lentivector set (Mouse)
K4631901 3 x 1.0 ug
EUR 339
Trappc9 sgRNA CRISPR Lentivector set (Rat)
K6652001 3 x 1.0 ug
EUR 339
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx145294-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
abx238949-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Trafficking Protein Particle Complex 9 (TRAPPC9) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442002 1.0 ug DNA
EUR 154
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442003 1.0 ug DNA
EUR 154
TRAPPC9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442004 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4631902 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4631903 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4631904 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6652002 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6652003 1.0 ug DNA
EUR 154
Trappc9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6652004 1.0 ug DNA
EUR 154
TRAPPC9 Protein Vector (Rat) (pPB-C-His)
PV312766 500 ng
EUR 1191
TRAPPC9 Protein Vector (Rat) (pPB-N-His)
PV312767 500 ng
EUR 1191
TRAPPC9 Protein Vector (Rat) (pPM-C-HA)
PV312768 500 ng
EUR 1191
TRAPPC9 Protein Vector (Rat) (pPM-C-His)
PV312769 500 ng
EUR 1191
TRAPPC9 Protein Vector (Human) (pPB-C-His)
PV137174 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPB-N-His)
PV137175 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPM-C-HA)
PV137176 500 ng Ask for price
TRAPPC9 Protein Vector (Human) (pPM-C-His)
PV137177 500 ng Ask for price
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241250 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241251 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241252 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241253 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241254 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241255 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241256 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPM-C-His)
PV241257 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPB-C-His)
PV241258 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPB-N-His)
PV241259 500 ng
EUR 1065
TRAPPC9 Protein Vector (Mouse) (pPM-C-HA)
PV241260 500 ng
EUR 1065