ST8SIA4 Antibody
47734-100ul 100ul
EUR 252
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST8SIA4 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ST8SIA4. Recognizes ST8SIA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ST8SIA4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA4. Recognizes ST8SIA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
ST8SIA4 Conjugated Antibody
C47734 100ul
EUR 397
ST8SIA4 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA4 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA4 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST8SIA4 Polyclonal Antibody
A66266 100 µg
EUR 570.55
Description: Ask the seller for details
ST8SIA4 Rabbit pAb
A6754-100ul 100 ul
EUR 308
ST8SIA4 Rabbit pAb
A6754-200ul 200 ul
EUR 459
ST8SIA4 Rabbit pAb
A6754-20ul 20 ul
EUR 183
ST8SIA4 Rabbit pAb
A6754-50ul 50 ul
EUR 223
ST8SIA4 Blocking Peptide
33R-2214 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST8SIA4 antibody, catalog no. 70R-5238
ST8SIA4 cloning plasmid
CSB-CL821630HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 507
  • Sequence: atgcgctccattaggaagaagtggacgatctgcacaataagtctgctcctgatcttttataagacaaaagaaatagcaagaactgaggagcaccaggagacgcaactcatcggagatggtgaattgtctttgagtcggtcacttgtcaatagctctgataaaatcattcgaaaggc
  • Show more
Description: A cloning plasmid for the ST8SIA4 gene.
Anti-ST8SIA4 antibody
STJ28837 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene.
ELI-18666h 96 Tests
EUR 824
Mouse St8sia4 ELISA KIT
ELI-29705m 96 Tests
EUR 865
ELI-30392b 96 Tests
EUR 928
Human ST8SIA4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ST8SIA4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST8SIA4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA4. Recognizes ST8SIA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST8SIA4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA4. Recognizes ST8SIA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST8SIA4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST8SIA4. Recognizes ST8SIA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ST8SIA4 Recombinant Protein (Human)
RP030268 100 ug Ask for price
ST8SIA4 Recombinant Protein (Rat)
RP231284 100 ug Ask for price
ST8SIA4 Recombinant Protein (Mouse)
RP175838 100 ug Ask for price
ST8SIA4 Recombinant Protein (Mouse)
RP175841 100 ug Ask for price
PVT16249 2 ug
EUR 325
ST8SIA4 Polyclonal Antibody, HRP Conjugated
A66267 100 µg
EUR 570.55
Description: The best epigenetics products
ST8SIA4 Polyclonal Antibody, FITC Conjugated
A66268 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST8SIA4 Polyclonal Antibody, Biotin Conjugated
A66269 100 µg
EUR 570.55
Description: fast delivery possible
h ST8SIA4 inducible lentiviral particles
LVP639 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: ST8SIA4 (ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 ), [alternative names: PST; PST1; SIAT8D; ST8SIA-IV]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005668. It also contains a RFP-Blasticidin dual selection marker.
St8sia4 ORF Vector (Mouse) (pORF)
ORF058614 1.0 ug DNA
EUR 506
St8sia4 ORF Vector (Mouse) (pORF)
ORF058615 1.0 ug DNA
EUR 506
ST8SIA4 ORF Vector (Human) (pORF)
ORF010090 1.0 ug DNA
EUR 95
St8sia4 ORF Vector (Rat) (pORF)
ORF077096 1.0 ug DNA
EUR 506
ST8SIA4 sgRNA CRISPR Lentivector set (Human)
K2296701 3 x 1.0 ug
EUR 339
St8sia4 sgRNA CRISPR Lentivector set (Mouse)
K3407701 3 x 1.0 ug
EUR 339
St8sia4 sgRNA CRISPR Lentivector set (Rat)
K7095901 3 x 1.0 ug
EUR 339
ST8SIA4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2296702 1.0 ug DNA
EUR 154
ST8SIA4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2296703 1.0 ug DNA
EUR 154
ST8SIA4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2296704 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3407702 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3407703 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3407704 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7095902 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7095903 1.0 ug DNA
EUR 154
St8sia4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7095904 1.0 ug DNA
EUR 154
ST8SIA4 Protein Vector (Human) (pPB-C-His)
PV040357 500 ng
EUR 329
ST8SIA4 Protein Vector (Human) (pPB-N-His)
PV040358 500 ng
EUR 329
ST8SIA4 Protein Vector (Human) (pPM-C-HA)
PV040359 500 ng
EUR 329
ST8SIA4 Protein Vector (Human) (pPM-C-His)
PV040360 500 ng
EUR 329
ST8SIA4 Protein Vector (Rat) (pPB-C-His)
PV308382 500 ng
EUR 603
ST8SIA4 Protein Vector (Rat) (pPB-N-His)
PV308383 500 ng
EUR 603
ST8SIA4 Protein Vector (Rat) (pPM-C-HA)
PV308384 500 ng
EUR 603
ST8SIA4 Protein Vector (Rat) (pPM-C-His)
PV308385 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPB-C-His)
PV234454 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPB-N-His)
PV234455 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPM-C-HA)
PV234456 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPM-C-His)
PV234457 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPB-C-His)
PV234458 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPB-N-His)
PV234459 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPM-C-HA)
PV234460 500 ng
EUR 603
ST8SIA4 Protein Vector (Mouse) (pPM-C-His)
PV234461 500 ng
EUR 603
St8sia4 3'UTR GFP Stable Cell Line
TU169788 1.0 ml Ask for price
St8sia4 3'UTR Luciferase Stable Cell Line
TU119788 1.0 ml Ask for price
ST8SIA4 3'UTR GFP Stable Cell Line
TU074727 1.0 ml
EUR 1521
ST8SIA4 3'UTR Luciferase Stable Cell Line
TU024727 1.0 ml
EUR 1521
St8sia4 3'UTR Luciferase Stable Cell Line
TU221254 1.0 ml Ask for price
St8sia4 3'UTR GFP Stable Cell Line
TU271254 1.0 ml Ask for price
ST8SIA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV670249 1.0 ug DNA
EUR 682
ST8SIA4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV670253 1.0 ug DNA
EUR 682
ST8SIA4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV670254 1.0 ug DNA
EUR 682
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-100ug
QP7838-ec-100ug 100ug
EUR 408
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-10ug
QP7838-ec-10ug 10ug
EUR 200
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-1mg
QP7838-ec-1mg 1mg
EUR 1632
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-200ug
QP7838-ec-200ug 200ug
EUR 634
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-500ug
QP7838-ec-500ug 500ug
EUR 1060
Recombinant Human ST8SIA4 Protein, His-SUMO, E.coli-50ug
QP7838-ec-50ug 50ug
EUR 263
CMP-N-Acetylneuraminate-Poly-Alpha-2,8-Sialyltransferase (ST8SIA4) Antibody
abx034506-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
CMP-N-Acetylneuraminate-Poly-Alpha-2,8-Sialyltransferase (ST8SIA4) Antibody
abx034506-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CMP-N-Acetylneuraminate-Poly-Alpha-2,8-Sialyltransferase (ST8SIA4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
CMP-N-Acetylneuraminate-Poly-Alpha-2,8-Sialyltransferase (ST8SIA4) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.