ST3GAL5

ST3GAL5 siRNA
20-abx905308	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ST3GAL5 antibody
70R-1878	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal ST3GAL5 antibody raised against the N terminal of ST3GAL5

ST3GAL5 antibody
70R-20549	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ST3GAL5 antibody

ST3GAL5 siRNA
20-abx935320	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ST3GAL5 siRNA
20-abx935321	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ST3GAL5 Antibody
1-CSB-PA890769ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ST3GAL5 Antibody
1-CSB-PA890769ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ST3GAL5 Antibody
1-CSB-PA022755GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ST3GAL5. Recognizes ST3GAL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-ST3GAL5
YF-PA25215	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to ST3GAL5

anti- ST3GAL5 antibody
FNab08266	FN Test	100µg	EUR 548.75
Immunogen: ST3 beta-galactoside alpha-2,3-sialyltransferase 5 Uniprot ID: Q9UNP4 Gene ID: 8869 Research Area: Metabolism
Description: Antibody raised against ST3GAL5

ST3GAL5 Rabbit pAb
A7947-100ul	Abclonal	100 ul	EUR 308

ST3GAL5 Rabbit pAb
A7947-200ul	Abclonal	200 ul	EUR 459

ST3GAL5 Rabbit pAb
A7947-20ul	Abclonal	20 ul	EUR 183

ST3GAL5 Rabbit pAb
A7947-50ul	Abclonal	50 ul	EUR 223

ST3GAL5 Blocking Peptide
33R-2160	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST3GAL5 antibody, catalog no. 70R-1878

Human ST3GAL5 Antibody
32904-05111	AssayPro	150 ug	EUR 261

ST3GAL5 Polyclonal Antibody
31384-100ul	SAB	100ul	EUR 252

ST3GAL5 Polyclonal Antibody
31384-50ul	SAB	50ul	EUR 187

ST3GAL5 cloning plasmid
CSB-CL890769HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1173 Sequence: atgccaagtgagtacacctatgtgaaactgagaagtgattgctcgaggccttccctgcaatggtacacccgagctcaaagcaagatgagaaggcccagcttgttattaaaagacatcctcaaatgtacattgcttgtgtttggagtgtggatcctttatatcctcaagttaaatt Show more
Description: A cloning plasmid for the ST3GAL5 gene.

Anti-ST3GAL5 antibody
PAab08266	Lifescience Market	100 ug	EUR 386

Anti-ST3GAL5 antibody
STJ110256	St John's Laboratory	100 µl	EUR 277
Description: Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene.

ST3GAL5 Polyclonal Conjugated Antibody
C31384	SAB	100ul	EUR 397

Rat ST3GAL5 shRNA Plasmid
20-abx986772	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse St3gal5 ELISA KIT
ELI-19160m	Lifescience Market	96 Tests	EUR 865

ST3GAL5 ELISA KIT|Human
EF003264	Lifescience Market	96 Tests	EUR 689

Bovine ST3GAL5 ELISA KIT
ELI-39360b	Lifescience Market	96 Tests	EUR 928

Human ST3GAL5 ELISA KIT
ELI-40992h	Lifescience Market	96 Tests	EUR 824

Human ST3GAL5 shRNA Plasmid
20-abx955857	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ST3GAL5 protein (His tag)
80R-3551	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant ST3GAL5 protein (His tag)

Mouse ST3GAL5 shRNA Plasmid
20-abx972702	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ST3GAL5 Recombinant Protein (Human)
RP030229	ABM	100 ug	Ask for price

ST3GAL5 Recombinant Protein (Rat)
RP231245	ABM	100 ug	Ask for price

ST3GAL5 Recombinant Protein (Mouse)
RP175763	ABM	100 ug	Ask for price

ST3GAL5 Recombinant Protein (Mouse)
RP175766	ABM	100 ug	Ask for price

Polyclonal ST3GAL5 Antibody (C-term)
APR14410G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ST3GAL5 (C-term). This antibody is tested and proven to work in the following applications:

Human ST3GAL5 Antibody (Biotin Conjugate)
32904-05121	AssayPro	150 ug	EUR 369

St3gal5 ORF Vector (Mouse) (pORF)
ORF058589	ABM	1.0 ug DNA	EUR 506

St3gal5 ORF Vector (Mouse) (pORF)
ORF058590	ABM	1.0 ug DNA	EUR 506

ST3GAL5 ORF Vector (Human) (pORF)
ORF010077	ABM	1.0 ug DNA	EUR 95

St3gal5 ORF Vector (Rat) (pORF)
ORF077083	ABM	1.0 ug DNA	EUR 506

Human ST3GAL5 AssayLite Antibody (FITC Conjugate)
32904-05141	AssayPro	150 ug	EUR 428

Human ST3GAL5 AssayLite Antibody (RPE Conjugate)
32904-05151	AssayPro	150 ug	EUR 428

Human ST3GAL5 AssayLite Antibody (APC Conjugate)
32904-05161	AssayPro	150 ug	EUR 428

Human ST3GAL5 AssayLite Antibody (PerCP Conjugate)
32904-05171	AssayPro	150 ug	EUR 471

ST3GAL5 sgRNA CRISPR Lentivector set (Human)
K2294501	ABM	3 x 1.0 ug	EUR 339

St3gal5 sgRNA CRISPR Lentivector set (Mouse)
K3682201	ABM	3 x 1.0 ug	EUR 339

St3gal5 sgRNA CRISPR Lentivector set (Rat)
K7075601	ABM	3 x 1.0 ug	EUR 339

ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2294502	ABM	1.0 ug DNA	EUR 154

ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2294503	ABM	1.0 ug DNA	EUR 154

ST3GAL5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2294504	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3682202	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3682203	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3682204	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7075602	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7075603	ABM	1.0 ug DNA	EUR 154

St3gal5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7075604	ABM	1.0 ug DNA	EUR 154

ST3GAL5 Protein Vector (Human) (pPB-C-His)
PV040305	ABM	500 ng	EUR 329

ST3GAL5 Protein Vector (Human) (pPB-N-His)
PV040306	ABM	500 ng	EUR 329

ST3GAL5 Protein Vector (Human) (pPM-C-HA)
PV040307	ABM	500 ng	EUR 329

ST3GAL5 Protein Vector (Human) (pPM-C-His)
PV040308	ABM	500 ng	EUR 329

Recombinant Human ST3GAL5 Protein, His, E.coli-1mg
QP13602-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human ST3GAL5 Protein, His, E.coli-20ug
QP13602-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human ST3GAL5 Protein, His, E.coli-5ug
QP13602-5ug	EnQuireBio	5ug	EUR 155

ST3GAL5 Protein Vector (Rat) (pPB-C-His)
PV308330	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Rat) (pPB-N-His)
PV308331	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Rat) (pPM-C-HA)
PV308332	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Rat) (pPM-C-His)
PV308333	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPB-C-His)
PV234354	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPB-N-His)
PV234355	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPM-C-HA)
PV234356	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPM-C-His)
PV234357	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPB-C-His)
PV234358	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPB-N-His)
PV234359	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPM-C-HA)
PV234360	ABM	500 ng	EUR 603

ST3GAL5 Protein Vector (Mouse) (pPM-C-His)
PV234361	ABM	500 ng	EUR 603

St3gal5 3'UTR GFP Stable Cell Line
TU169772	ABM	1.0 ml	Ask for price

St3gal5 3'UTR Luciferase Stable Cell Line
TU119772	ABM	1.0 ml	Ask for price

ST3GAL5 3'UTR GFP Stable Cell Line
TU074705	ABM	1.0 ml	EUR 1521

ST3GAL5 3'UTR Luciferase Stable Cell Line
TU024705	ABM	1.0 ml	EUR 1521

St3gal5 3'UTR Luciferase Stable Cell Line
TU221241	ABM	1.0 ml	Ask for price

St3gal5 3'UTR GFP Stable Cell Line
TU271241	ABM	1.0 ml	Ask for price

ST3GAL5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV694261	ABM	1.0 ug DNA	EUR 682

ST3GAL5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV694265	ABM	1.0 ug DNA	EUR 682

ST3GAL5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV694266	ABM	1.0 ug DNA	EUR 682

St3 Beta Galactoside Alpha 2,3-Sialyltransferase 5 (ST3GAL5) Antibody
20-abx115828	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.