null
Toggle menu
020 3393 8531

    • We are part of the Gentaur group

    Shop by Category

  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • AffiPLASMID
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands
  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • AffiPLASMID
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands

    • RPL35A

    RPL35A

     

    RPL35A siRNA
    20-abx904663 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RPL35A Antibody
    abx147788-100ug Abbexa 100 ug
     
    EUR 439
    • Shipped within 5-10 working days.

    RPL35A Antibody
    ABD9131 Lifescience Market 100 ug
     
    EUR 438

    RPL35A Antibody
    ABD13240 Lifescience Market 100 ug
     
    EUR 438

    RPL35A Antibody
    43356-100ul SAB 100ul
     
    EUR 252

    RPL35A Antibody
    DF9131 Affbiotech 200ul
     
    EUR 304
    Description: RPL35A Antibody detects endogenous levels of total RPL35A.

    RPL35A siRNA
    20-abx931962 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RPL35A siRNA
    20-abx931963 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RPL35A Antibody
    1-CSB-PA020248LA01HU Cusabio
    •  
      EUR 317.00
    •  
      EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    anti-RPL35A
    YF-PA24612 Abfrontier 50 ul
     
    EUR 334
    Description: Mouse polyclonal to RPL35A

    RPL35A Conjugated Antibody
    C43356 SAB 100ul
     
    EUR 397

    RPL35A cloning plasmid
    CSB-CL020248HU-10ug Cusabio 10ug
     
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcac
    • Show more
    Description: A cloning plasmid for the RPL35A gene.

    RPL35A Polyclonal Antibody
    A54938 EpiGentek 100 µg
     
    EUR 570.55
    Description: kits suitable for this type of research

    RPL35A Rabbit pAb
    A17938-100ul Abclonal 100 ul
     
    EUR 308

    RPL35A Rabbit pAb
    A17938-200ul Abclonal 200 ul
     
    EUR 459

    RPL35A Rabbit pAb
    A17938-20ul Abclonal 20 ul
     
    EUR 183

    RPL35A Rabbit pAb
    A17938-50ul Abclonal 50 ul
     
    EUR 223

    Human RPL35A Antibody
    32788-05111 AssayPro 150 ug
     
    EUR 261

    RPL35A Blocking Peptide
    DF9131-BP Affbiotech 1mg
     
    EUR 195

    pCMV-SPORT6-RPL35A
    PVT13292 Lifescience Market 2 ug
     
    EUR 391

    Anti-RPL35A antibody
    STJ119922 St John's Laboratory 100 µl
     
    EUR 277

    Mouse RPL35A shRNA Plasmid
    20-abx975035 Abbexa
    •  
      EUR 801.00
    •  
      EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat RPL35A shRNA Plasmid
    20-abx985897 Abbexa
    •  
      EUR 801.00
    •  
      EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human RPL35A shRNA Plasmid
    20-abx954148 Abbexa
    •  
      EUR 801.00
    •  
      EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    There are no products listed under this category.

    Compare Selected