RGS8

RGS8 antibody

20R-1253 100 ug
EUR 377.00
Description: Rabbit polyclonal RGS8 antibody

RGS8 siRNA

20-abx904558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS8 antibody

70R-RR016 100 ug
EUR 300.00
Description: Affinity purified Rabbit polyclonal RGS8 antibody

RGS8 siRNA

20-abx931425
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS8 siRNA

20-abx931426
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RGS8

YF-PA21571 50 ul
EUR 363.00
Description: Mouse polyclonal to RGS8

RGS8 Rabbit pAb

A9987-100ul 100 ul
EUR 308.00

RGS8 Rabbit pAb

A9987-200ul 200 ul
EUR 459.00

RGS8 Rabbit pAb

A9987-20ul 20 ul
EUR 183.00

RGS8 Rabbit pAb

A9987-50ul 50 ul
EUR 223.00

RGS8 Blocking Peptide

33R-6742 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS8 antibody, catalog no. 20R-1253

RGS8 Polyclonal Antibody

31798-100ul 100ul
EUR 252.00

RGS8 Polyclonal Antibody

31798-50ul 50ul
EUR 187.00

RGS8 cloning plasmid

CSB-CL019661HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atggcggccttactgatgccacgcaggaacaaagggatgaggactcgactgggatgcctgtctcacaagtcagactcgtgtagtgatttcacagctattcttccagacaaacccaaccgcgctctcaagagattatcgacagaagaagctacgaggtgggcagattcctttgatgt
  • Show more
Description: A cloning plasmid for the RGS8 gene.

RGS8 cloning plasmid

CSB-CL019661HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 597
  • Sequence: atgtggaacaccttaacccgaagcctctctgaccatccagttggcaaagaccctcaggccatgaggactggccaaagacagaacaaagggatgaggactcgactgggatgcctgtctcacaagtcagactcgtgtagtgatttcacagctattcttccagacaaacccaaccgcgc
  • Show more
Description: A cloning plasmid for the RGS8 gene.

Anti-RGS8 antibody

STJ112028 100 µl
EUR 277.00
Description: This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation.

Rat RGS8 shRNA Plasmid

20-abx985827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RGS8 shRNA Plasmid

20-abx976323
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS8 Polyclonal Conjugated Antibody

C31798 100ul
EUR 397.00

Human RGS8 shRNA Plasmid

20-abx963795
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS8 Recombinant Protein (Human)

RP026344 100 ug Ask for price

RGS8 Recombinant Protein (Human)

RP026347 100 ug Ask for price

RGS8 Recombinant Protein (Mouse)

RP167933 100 ug Ask for price

RGS8 Recombinant Protein (Rat)

RP225971 100 ug Ask for price

RGS8 ORF Vector (Human) (pORF)

ORF008782 1.0 ug DNA
EUR 95.00

RGS8 ORF Vector (Human) (pORF)

ORF008783 1.0 ug DNA
EUR 95.00

Rgs8 ORF Vector (Mouse) (pORF)

ORF055979 1.0 ug DNA
EUR 506.00

Rgs8 ORF Vector (Rat) (pORF)

ORF075325 1.0 ug DNA
EUR 506.00

RGS8 sgRNA CRISPR Lentivector set (Human)

K1817401 3 x 1.0 ug
EUR 339.00

Rgs8 sgRNA CRISPR Lentivector set (Mouse)

K4710301 3 x 1.0 ug
EUR 339.00

Rgs8 sgRNA CRISPR Lentivector set (Rat)

K6792601 3 x 1.0 ug
EUR 339.00

RGS8 sgRNA CRISPR Lentivector (Human) (Target 1)

K1817402 1.0 ug DNA
EUR 154.00

RGS8 sgRNA CRISPR Lentivector (Human) (Target 2)

K1817403 1.0 ug DNA
EUR 154.00

RGS8 sgRNA CRISPR Lentivector (Human) (Target 3)

K1817404 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4710302 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4710303 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4710304 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6792602 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6792603 1.0 ug DNA
EUR 154.00

Rgs8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6792604 1.0 ug DNA
EUR 154.00

RGS8 Protein Vector (Mouse) (pPB-C-His)

PV223914 500 ng
EUR 603.00

RGS8 Protein Vector (Mouse) (pPB-N-His)

PV223915 500 ng
EUR 603.00

RGS8 Protein Vector (Mouse) (pPM-C-HA)

PV223916 500 ng
EUR 603.00

RGS8 Protein Vector (Mouse) (pPM-C-His)

PV223917 500 ng
EUR 603.00

RGS8 Protein Vector (Human) (pPB-C-His)

PV035125 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPB-N-His)

PV035126 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPM-C-HA)

PV035127 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPM-C-His)

PV035128 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPB-C-His)

PV035129 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPB-N-His)

PV035130 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPM-C-HA)

PV035131 500 ng
EUR 329.00

RGS8 Protein Vector (Human) (pPM-C-His)

PV035132 500 ng
EUR 329.00

RGS8 Protein Vector (Rat) (pPB-C-His)

PV301298 500 ng
EUR 603.00

RGS8 Protein Vector (Rat) (pPB-N-His)

PV301299 500 ng
EUR 603.00

RGS8 Protein Vector (Rat) (pPM-C-HA)

PV301300 500 ng
EUR 603.00

RGS8 Protein Vector (Rat) (pPM-C-His)

PV301301 500 ng
EUR 603.00

RGS8 3'UTR GFP Stable Cell Line

TU069844 1.0 ml
EUR 1394.00

Rgs8 3'UTR Luciferase Stable Cell Line

TU117808 1.0 ml Ask for price

RGS8 3'UTR Luciferase Stable Cell Line

TU019844 1.0 ml
EUR 1394.00

Rgs8 3'UTR Luciferase Stable Cell Line

TU219383 1.0 ml Ask for price

Rgs8 3'UTR GFP Stable Cell Line

TU167808 1.0 ml Ask for price

Rgs8 3'UTR GFP Stable Cell Line

TU269383 1.0 ml Ask for price

Regulator of G-Protein Signaling 8 (RGS8) Antibody

abx028801-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 8 (RGS8) Antibody

abx028801-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Regulator of G-Protein Signaling 8 (RGS8) Antibody

20-abx135907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RGS8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV714321 1.0 ug DNA
EUR 316.00

RGS8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV714325 1.0 ug DNA
EUR 316.00

RGS8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV714326 1.0 ug DNA
EUR 316.00

RGS8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690451 1.0 ug DNA
EUR 514.00

RGS8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690455 1.0 ug DNA
EUR 514.00

RGS8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690456 1.0 ug DNA
EUR 514.00

Regulator of G-protein signalling 8 (RGS8) polyclonal antibody

ABP-PAB-10262 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Human Regulator of G- protein signaling 8, RGS8 ELISA KIT

ELI-21893h 96 Tests
EUR 824.00

Mouse Regulator of G- protein signaling 8, Rgs8 ELISA KIT

ELI-21894m 96 Tests
EUR 865.00

RGS8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1817405 3 x 1.0 ug
EUR 376.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4710305 3 x 1.0 ug
EUR 376.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6792605 3 x 1.0 ug
EUR 376.00

RGS8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1817406 1.0 ug DNA
EUR 167.00

RGS8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1817407 1.0 ug DNA
EUR 167.00

RGS8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1817408 1.0 ug DNA
EUR 167.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4710306 1.0 ug DNA
EUR 167.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4710307 1.0 ug DNA
EUR 167.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4710308 1.0 ug DNA
EUR 167.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6792606 1.0 ug DNA
EUR 167.00

Rgs8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6792607 1.0 ug DNA
EUR 167.00