RAB5C

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
DLR-RAB5C-Hu-96T	DL Develop	96T	EUR 725
Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RDR-RAB5C-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RDR-RAB5C-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RD-RAB5C-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RD-RAB5C-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

RAB5C Antibody
36745-100ul	SAB	100ul	EUR 252

RAB5C Antibody
1-CSB-PA097939	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

RAB5C Antibody
DF4406	Affbiotech	200ul	EUR 304
Description: RAB5C Antibody detects endogenous levels of total RAB5C.

RAB5C Antibody
1-CSB-PA040136	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RAB5C Antibody
1-CSB-PA041280	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RAB5C antibody
70R-9551	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RAB5C antibody

RAB5C Antibody
1-CSB-PA019215DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB5C Antibody
1-CSB-PA019215DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5C. Recognizes RAB5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB5C siRNA
20-abx930697	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB5C siRNA
20-abx930698	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB5C Antibody
ABD4406	Lifescience Market	100 ug	EUR 438

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx006922	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
abx216507-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx212323	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx213565	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx119126	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx133436	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx320910	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx320911	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB5C, Member RAS Oncogene Family (RAB5C) Antibody
20-abx329139	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-RAB5C Antibody
A05148	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RAB5C Antibody. Validated in WB and tested in Human, Mouse, Rat.

RAB5C Blocking Peptide
33R-4673	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5C antibody, catalog no. 70R-9551

RAB5C Blocking Peptide
DF4406-BP	Affbiotech	1mg	EUR 195

RAB5C Blocking Peptide
20-abx162145	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RAB5C Conjugated Antibody
C36745	SAB	100ul	EUR 397

RAB5C cloning plasmid
CSB-CL019215HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 651 Sequence: ATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGCTGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGCCTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCT Show more
Description: A cloning plasmid for the RAB5C gene.

RAB5C Rabbit pAb
A7342-100ul	Abclonal	100 ul	EUR 308

RAB5C Rabbit pAb
A7342-200ul	Abclonal	200 ul	EUR 459

RAB5C Rabbit pAb
A7342-20ul	Abclonal	20 ul	EUR 183

RAB5C Rabbit pAb
A7342-50ul	Abclonal	50 ul	EUR 223

Anti-RAB5C antibody
STJ13100303	St John's Laboratory	100 µl	EUR 427

Anti-Rab5c antibody
STJ140062	St John's Laboratory	150 µg	EUR 231
Description: Goat polyclonal antibody to Rab5c. Rab5c belongs to the small GTPase superfamily, Rab family. Rab5c is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.

Anti-RAB5C antibody
STJ29481	St John's Laboratory	100 µl	EUR 277

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
20-abx258183	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RAB5C, Member RAS Oncogene Family (RAB5C) CLIA Kit
20-abx496137	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.

Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
4-SEP757Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL RAB5CL Ras-related protein Rab-5C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB5C (RAB5C, Member RAS Oncogene Family)
ELK7498	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB5C, Member RAS Oncogene Family (RAB5C). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB5C, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB5C protein (His tag)
80R-2752	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant RAB5C protein (His tag)

Mouse RAB5C shRNA Plasmid
20-abx972350	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB5C shRNA Plasmid
20-abx953968	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RAB5C ELISA KIT
ELI-37953d	Lifescience Market	96 Tests	EUR 928

RAB5C Recombinant Protein (Human)
RP042688	ABM	100 ug	Ask for price

RAB5C Recombinant Protein (Mouse)
RP166358	ABM	100 ug	Ask for price

RAB5C Recombinant Protein (Rat)
RP223376	ABM	100 ug	Ask for price

Monoclonal RAB5C Antibody, Clone: 1616CT314.65.31
AMM07482G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human RAB5C. The antibodies are raised in Mouse and are from clone 1616CT314.65.31. This antibody is applicable in FC, WB, E

Polyclonal RAB5C Antibody (C-term)
AMM07483G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5C (C-term). This antibody is tested and proven to work in the following applications:

Rab5c ORF Vector (Rat) (pORF)
ORF074460	ABM	1.0 ug DNA	EUR 506

RAB5C ORF Vector (Human) (pORF)
ORF014230	ABM	1.0 ug DNA	EUR 354

Rab5c ORF Vector (Mouse) (pORF)
ORF055454	ABM	1.0 ug DNA	EUR 506

RAB5C ELISA Kit (Human) (OKCD02087)
OKCD02087	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Protein transport. Probably involved in vesicular traffic.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

RAB5C, Member RAS Oncogene Family Protein
20-abx261048	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Rab5c sgRNA CRISPR Lentivector set (Rat)
K6147701	ABM	3 x 1.0 ug	EUR 339

Rab5c sgRNA CRISPR Lentivector set (Mouse)
K4484201	ABM	3 x 1.0 ug	EUR 339

RAB5C sgRNA CRISPR Lentivector set (Human)
K1769601	ABM	3 x 1.0 ug	EUR 339

Human Ras-related protein Rab-5C (RAB5C)
1-CSB-EP019215HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-5C(RAB5C) expressed in E.coli

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6147702	ABM	1.0 ug DNA	EUR 154

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6147703	ABM	1.0 ug DNA	EUR 154

Rab5c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6147704	ABM	1.0 ug DNA	EUR 154

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4484202	ABM	1.0 ug DNA	EUR 154

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4484203	ABM	1.0 ug DNA	EUR 154

Rab5c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4484204	ABM	1.0 ug DNA	EUR 154

RAB5C sgRNA CRISPR Lentivector (Human) (Target 1)
K1769602	ABM	1.0 ug DNA	EUR 154

RAB5C sgRNA CRISPR Lentivector (Human) (Target 2)
K1769603	ABM	1.0 ug DNA	EUR 154

RAB5C sgRNA CRISPR Lentivector (Human) (Target 3)
K1769604	ABM	1.0 ug DNA	EUR 154

RAB5C Protein Vector (Rat) (pPB-C-His)
PV297838	ABM	500 ng	EUR 603

RAB5C Protein Vector (Rat) (pPB-N-His)
PV297839	ABM	500 ng	EUR 603

RAB5C Protein Vector (Rat) (pPM-C-HA)
PV297840	ABM	500 ng	EUR 603

RAB5C Protein Vector (Rat) (pPM-C-His)
PV297841	ABM	500 ng	EUR 603

RAB5C Protein Vector (Human) (pPB-C-His)
PV056917	ABM	500 ng	EUR 481

RAB5C Protein Vector (Human) (pPB-N-His)
PV056918	ABM	500 ng	EUR 481

RAB5C Protein Vector (Human) (pPM-C-HA)
PV056919	ABM	500 ng	EUR 481

RAB5C Protein Vector (Human) (pPM-C-His)
PV056920	ABM	500 ng	EUR 481

RAB5C Protein Vector (Mouse) (pPB-C-His)
PV221814	ABM	500 ng	EUR 603

RAB5C Protein Vector (Mouse) (pPB-N-His)
PV221815	ABM	500 ng	EUR 603

RAB5C Protein Vector (Mouse) (pPM-C-HA)
PV221816	ABM	500 ng	EUR 603

RAB5C Protein Vector (Mouse) (pPM-C-His)
PV221817	ABM	500 ng	EUR 603