PMM2

PMM2 Antibody

39827-100ul 100ul
EUR 390.00

PMM2 antibody

70R-35379 100 ug
EUR 349.00
Description: Purified Rabbit polyclonal PMM2 antibody

PMM2 antibody

70R-19368 50 ul
EUR 435.00
Description: Rabbit polyclonal PMM2 antibody

PMM2 antibody

70R-13583 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal PMM2 antibody

PMM2 siRNA

20-abx929043
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMM2 siRNA

20-abx929044
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMM2 Antibody

1-CSB-PA018238ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PMM2. Recognizes PMM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

PMM2 Antibody

1-CSB-PA018238GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PMM2. Recognizes PMM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PMM2 Antibody

DF12455 200ul
EUR 304.00
Description: PMM2 antibody detects endogenous levels of PMM2.

anti-PMM2

YF-PA13843 50 ul
EUR 363.00
Description: Mouse polyclonal to PMM2

anti-PMM2

YF-PA13844 100 ul
EUR 403.00
Description: Rabbit polyclonal to PMM2

anti-PMM2

YF-PA24406 50 ul
EUR 334.00
Description: Mouse polyclonal to PMM2

PMM2 Polyclonal Antibody

30513-100ul 100ul
EUR 252.00

PMM2 Polyclonal Antibody

30513-50ul 50ul
EUR 187.00

Human PMM2 Antibody

33120-05111 150 ug
EUR 261.00

anti- PMM2 antibody

FNab06574 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: phosphomannomutase 2
  • Uniprot ID: O15305
  • Gene ID: 5373
  • Research Area: Metabolism
Description: Antibody raised against PMM2

PMM2 Rabbit pAb

A4026-100ul 100 ul
EUR 308.00

PMM2 Rabbit pAb

A4026-200ul 200 ul
EUR 459.00

PMM2 Rabbit pAb

A4026-20ul 20 ul
EUR 183.00

PMM2 Rabbit pAb

A4026-50ul 50 ul
EUR 223.00

PMM2 cloning plasmid

CSB-CL018238HU-10ug 10ug
EUR 317.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atggcagcgcctggcccagcgctctgcctcttcgacgtggatgggaccctcaccgccccgcggcagaaaattaccaaagaaatggatgacttcctacaaaaattgaggcagaagatcaaaatcggagtggtaggcggatcggactttgagaaagtgcaggagcaactgggaaatga
  • Show more
Description: A cloning plasmid for the PMM2 gene.

PMM2 Blocking Peptide

DF12455-BP 1mg
EUR 195.00

Anti-PMM2 antibody

PAab06574 100 ug
EUR 355.00

Anti-PMM2 antibody

STJ25035 100 µl
EUR 277.00
Description: The protein encoded by this gene catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate, which is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. Mutations in this gene have been shown to cause defects in glycoprotein biosynthesis, which manifests as carbohydrate-deficient glycoprotein syndrome type I.

Anti-PMM2 (2E9)

YF-MA14784 100 ug
EUR 363.00
Description: Mouse monoclonal to PMM2

Anti-PMM2 (2A5)

YF-MA14785 100 ug
EUR 363.00
Description: Mouse monoclonal to PMM2

Phosphomannomutase 2 (PMM2) Antibody

20-abx002953
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx030709-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx030709-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx036284-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Mouse PMM2 shRNA Plasmid

20-abx974418
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phosphomannomutase 2 (PMM2) Antibody

20-abx321398
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

20-abx114495
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 2 (PMM2) Antibody

abx236574-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

PMM2 protein (His tag)

80R-1489 100 ug
EUR 305.00
Description: Purified recombinant Human PMM2 protein

PMM2 ELISA KIT|Human

EF001886 96 Tests
EUR 689.00

PMM2 Polyclonal Conjugated Antibody

C30513 100ul
EUR 397.00

Human PMM2 shRNA Plasmid

20-abx953608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Phosphomannomutase 2 (PMM2)

1-CSB-EP018238HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphomannomutase 2(PMM2) expressed in E.coli

PMM2 Recombinant Protein (Human)

RP023899 100 ug Ask for price

PMM2 Recombinant Protein (Mouse)

RP163076 100 ug Ask for price

PMM2 Recombinant Protein (Rat)

RP221126 100 ug Ask for price

Human PMM2 Antibody (Biotin Conjugate)

33120-05121 150 ug
EUR 369.00

Polyclonal PMM2 Antibody (C-term)

AMR09398G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PMM2 (C-term). This antibody is tested and proven to work in the following applications:

PMM2 ORF Vector (Human) (pORF)

ORF007967 1.0 ug DNA
EUR 95.00

Pmm2 ORF Vector (Mouse) (pORF)

ORF054360 1.0 ug DNA
EUR 506.00

Pmm2 ORF Vector (Rat) (pORF)

ORF073710 1.0 ug DNA
EUR 506.00

Human PMM2 AssayLite Antibody (FITC Conjugate)

33120-05141 150 ug
EUR 428.00

Human PMM2 AssayLite Antibody (RPE Conjugate)

33120-05151 150 ug
EUR 428.00

Human PMM2 AssayLite Antibody (APC Conjugate)

33120-05161 150 ug
EUR 428.00

Human PMM2 AssayLite Antibody (PerCP Conjugate)

33120-05171 150 ug
EUR 471.00

Polyclonal PMM2 antibody - N-terminal region

AMR09401G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PMM2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Phosphomannomutase 2 (PMM2) ELISA Kit

abx382314-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Bovine Phosphomannomutase 2, PMM2 ELISA KIT

ELI-16337b 96 Tests
EUR 928.00

Human Phosphomannomutase 2, PMM2 ELISA KIT

ELI-19693h 96 Tests
EUR 824.00