NEU4

NEU4 siRNA
20-abx925762	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEU4 antibody
70R-4135	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NEU4 antibody raised against the N terminal of NEU4

NEU4 antibody
70R-18848	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NEU4 antibody

NEU4 Antibody
DF12123	Affbiotech	200ul	EUR 304
Description: NEU4 antibody detects endogenous levels of NEU4.

NEU4 Antibody
1-CSB-PA848831LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

NEU4 Antibody
1-CSB-PA015720GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti- NEU4 antibody
FNab05668	FN Test	100µg	EUR 585
Immunogen: sialidase 4 Uniprot ID: Q8WWR8 Gene ID: 129807 Research Area: Neuroscience, Metabolism
Description: Antibody raised against NEU4

NEU4 Rabbit pAb
A5141-100ul	Abclonal	100 ul	EUR 308

NEU4 Rabbit pAb
A5141-200ul	Abclonal	200 ul	EUR 459

NEU4 Rabbit pAb
A5141-20ul	Abclonal	20 ul	EUR 183

NEU4 Rabbit pAb
A5141-50ul	Abclonal	50 ul	EUR 223

NEU4 Polyclonal Antibody
A70123	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

NEU4 Blocking Peptide
33R-9097	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEU4 antibody, catalog no. 70R-4135

NEU4 Polyclonal Antibody
30638-100ul	SAB	100ul	EUR 252

NEU4 Polyclonal Antibody
30638-50ul	SAB	50ul	EUR 187

NEU4 Blocking Peptide
DF12123-BP	Affbiotech	1mg	EUR 195

NEU4 cloning plasmid
CSB-CL848831HU1-10ug	Cusabio	10ug	EUR 304
Formulation: 10 μg plasmid + 200μl Glycerol Length: 693 Sequence: atgctggcacgggcaccgtcttcctcttcttcatcgcggtgctgggccacacgcctgaggccgtgcagatcgccacgggaaggaacgccgcgcgcctctgctgtgtggccagccgtgacgccggcctctcgtggggcagcgcccgggacctcaccgaggaggccatcggtggtgcc Show more
Description: A cloning plasmid for the NEU4 gene.

NEU4 cloning plasmid
CSB-CL848831HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1491 Sequence: atgatgagctctgcagccttcccaaggtggctgagcatgggggtccctcgtaccccttcacggacagtgctcttcgagcgggagaggacgggcctgacctaccgcgtgccctcgctgctccccgtgccccccgggcccaccctgctggcctttgtggagcagcggctcagccctg Show more
Description: A cloning plasmid for the NEU4 gene.

Anti-NEU4 antibody
PAab05668	Lifescience Market	100 ug	EUR 412

pCMV-SPORT6-NEU4
PVT14097	Lifescience Market	2 ug	EUR 391

Anti-NEU4 antibody
STJ27123	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to a family of glycohydrolytic enzymes, which remove terminal sialic acid residues from various sialo derivatives, such as glycoproteins, glycolipids, oligosaccharides, and gangliosides. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

NEU4 Polyclonal Conjugated Antibody
C30638	SAB	100ul	EUR 397

Human NEU4 shRNA Plasmid
20-abx965010	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NEU4 ELISA KIT|Human
EF001183	Lifescience Market	96 Tests	EUR 689

Sialidase 4 (NEU4) Antibody
20-abx116870	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody
abx025695-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody
abx025695-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody
20-abx003937	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody
20-abx334228	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuraminidase 4 (NEU4) Antibody
abx235668-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Mouse NEU4 shRNA Plasmid
20-abx982498	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NEU4 Antibody, HRP conjugated
1-CSB-PA848831LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEU4 Antibody, FITC conjugated
1-CSB-PA848831LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEU4 Antibody, Biotin conjugated
1-CSB-PA848831LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU4. Recognizes NEU4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NEU4 Recombinant Protein (Human)
RP021088	ABM	100 ug	Ask for price

NEU4 Recombinant Protein (Human)
RP041620	ABM	100 ug	Ask for price

NEU4 Recombinant Protein (Rat)
RP213719	ABM	100 ug	Ask for price

NEU4 Recombinant Protein (Mouse)
RP153746	ABM	100 ug	Ask for price

Sialidase 4 (NEU4) Antibody (HRP)
20-abx337688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody (FITC)
20-abx337689	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sialidase 4 (NEU4) Antibody (Biotin)
20-abx337690	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NEU4 Polyclonal Antibody, HRP Conjugated
A70124	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

NEU4 Polyclonal Antibody, FITC Conjugated
A70125	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

NEU4 Polyclonal Antibody, Biotin Conjugated
A70126	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

NEU4 ORF Vector (Human) (pORF)
ORF007030	ABM	1.0 ug DNA	EUR 95

Neu4 ORF Vector (Rat) (pORF)
ORF071241	ABM	1.0 ug DNA	EUR 506

NEU4 ORF Vector (Human) (pORF)
ORF013874	ABM	1.0 ug DNA	EUR 354

Neu4 ORF Vector (Mouse) (pORF)
ORF051250	ABM	1.0 ug DNA	EUR 506

Mouse Sialidase- 4, Neu4 ELISA KIT
ELI-13819m	Lifescience Market	96 Tests	EUR 865

Human Sialidase- 4, NEU4 ELISA KIT
ELI-16463h	Lifescience Market	96 Tests	EUR 824

NEU4 sgRNA CRISPR Lentivector set (Human)
K1418501	ABM	3 x 1.0 ug	EUR 339

Neu4 sgRNA CRISPR Lentivector set (Mouse)
K3003401	ABM	3 x 1.0 ug	EUR 339

Neu4 sgRNA CRISPR Lentivector set (Mouse)
K3613601	ABM	3 x 1.0 ug	EUR 339

Neu4 sgRNA CRISPR Lentivector set (Rat)
K6573801	ABM	3 x 1.0 ug	EUR 339

NEU4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1418502	ABM	1.0 ug DNA	EUR 154

NEU4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1418503	ABM	1.0 ug DNA	EUR 154

NEU4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1418504	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3003402	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3003403	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3003404	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3613602	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3613603	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3613604	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6573802	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6573803	ABM	1.0 ug DNA	EUR 154

Neu4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6573804	ABM	1.0 ug DNA	EUR 154

NEU4 Protein Vector (Human) (pPB-C-His)
PV055493	ABM	500 ng	EUR 481

NEU4 Protein Vector (Human) (pPB-N-His)
PV055494	ABM	500 ng	EUR 481

NEU4 Protein Vector (Human) (pPM-C-HA)
PV055495	ABM	500 ng	EUR 481

NEU4 Protein Vector (Human) (pPM-C-His)
PV055496	ABM	500 ng	EUR 481

NEU4 Protein Vector (Rat) (pPB-C-His)
PV284962	ABM	500 ng	EUR 603

NEU4 Protein Vector (Rat) (pPB-N-His)
PV284963	ABM	500 ng	EUR 603

NEU4 Protein Vector (Rat) (pPM-C-HA)
PV284964	ABM	500 ng	EUR 603

NEU4 Protein Vector (Rat) (pPM-C-His)
PV284965	ABM	500 ng	EUR 603

NEU4 Protein Vector (Human) (pPB-C-His)
PV028117	ABM	500 ng	EUR 329

NEU4 Protein Vector (Human) (pPB-N-His)
PV028118	ABM	500 ng	EUR 329

NEU4 Protein Vector (Human) (pPM-C-HA)
PV028119	ABM	500 ng	EUR 329

NEU4 Protein Vector (Human) (pPM-C-His)
PV028120	ABM	500 ng	EUR 329

NEU4 Protein Vector (Mouse) (pPB-C-His)
PV204998	ABM	500 ng	EUR 603

NEU4 Protein Vector (Mouse) (pPB-N-His)
PV204999	ABM	500 ng	EUR 603

NEU4 Protein Vector (Mouse) (pPM-C-HA)
PV205000	ABM	500 ng	EUR 603

NEU4 Protein Vector (Mouse) (pPM-C-His)
PV205001	ABM	500 ng	EUR 603

Neu4 3'UTR GFP Stable Cell Line
TU164008	ABM	1.0 ml	Ask for price

Neu4 3'UTR Luciferase Stable Cell Line
TU213903	ABM	1.0 ml	Ask for price

NEU4 3'UTR Luciferase Stable Cell Line
TU015593	ABM	1.0 ml	EUR 1521

Neu4 3'UTR Luciferase Stable Cell Line
TU114008	ABM	1.0 ml	Ask for price

NEU4 3'UTR GFP Stable Cell Line
TU065593	ABM	1.0 ml	EUR 1521

Neu4 3'UTR GFP Stable Cell Line
TU263903	ABM	1.0 ml	Ask for price

NEU4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702639	ABM	1.0 ug DNA	EUR 450

NEU4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702643	ABM	1.0 ug DNA	EUR 450

NEU4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702644	ABM	1.0 ug DNA	EUR 450

NEU4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1418505	ABM	3 x 1.0 ug	EUR 376

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3003405	ABM	3 x 1.0 ug	EUR 376

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3613605	ABM	3 x 1.0 ug	EUR 376

Neu4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6573805	ABM	3 x 1.0 ug	EUR 376