IGF2

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-b-96T 96T
EUR 641
  • Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Hu-48T 48T
EUR 425
  • Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Hu-96T 96T
EUR 548
  • Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Mu-48T 48T
EUR 435
  • Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Mu-96T 96T
EUR 561
  • Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-p-48T 48T
EUR 493
  • Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-p-96T 96T
EUR 641
  • Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Ra-48T 48T
EUR 454
  • Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Ra-96T 96T
EUR 587
  • Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Rb-48T 48T
EUR 454
  • Should the Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Rb-96T 96T
EUR 587
  • Should the Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-b-48Tests 48 Tests
EUR 494

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-b-96Tests 96 Tests
EUR 684

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Hu-48Tests 48 Tests
EUR 418

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Hu-96Tests 96 Tests
EUR 575

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Mu-48Tests 48 Tests
EUR 429

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Mu-96Tests 96 Tests
EUR 591

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-p-48Tests 48 Tests
EUR 494

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-p-96Tests 96 Tests
EUR 684

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Ra-48Tests 48 Tests
EUR 450

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Ra-96Tests 96 Tests
EUR 622

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Rb-48Tests 48 Tests
EUR 450

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Rb-96Tests 96 Tests
EUR 622

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-b-48Tests 48 Tests
EUR 516

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-b-96Tests 96 Tests
EUR 716

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Hu-48Tests 48 Tests
EUR 436

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Hu-96Tests 96 Tests
EUR 601

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Mu-48Tests 48 Tests
EUR 447

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Mu-96Tests 96 Tests
EUR 618

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-p-48Tests 48 Tests
EUR 516

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-p-96Tests 96 Tests
EUR 716

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Ra-48Tests 48 Tests
EUR 470

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Ra-96Tests 96 Tests
EUR 651

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Rb-48Tests 48 Tests
EUR 470

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Rb-96Tests 96 Tests
EUR 651

IGF2

E21-F61 10ug
EUR 343

IGF2

LF-PR027 50 ug
EUR 177
Description: IGF2 protein

IGF2 Antibody

BF0039 200ul
EUR 376
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody

ABD2516 100 ug
EUR 438

IGF2 Antibody

ABD6810 100 ug
EUR 438

IGF2 Antibody

49302-100ul 100ul
EUR 333

IGF2 Antibody

49302-50ul 50ul
EUR 239

IGF2 antibody

10R-I135a 100 ug
EUR 555
Description: Mouse monoclonal IGF2 antibody

IGF2 protein

30R-1836 50 ug
EUR 397
Description: Purified recombinant Human IGF2 protein

IGF2 protein

30-AI89 50 ug
EUR 298
Description: Purified recombinant Human IGF2 protein

IGF2 Antibody

32592-100ul 100ul
EUR 252

IGF2 antibody

70R-12270 100 ug
EUR 460
Description: Rabbit polyclonal IGF2 antibody

IGF2 antibody

70-IR16 50 ug
EUR 327
Description: Affinity purified Rabbit polyclonal IGF2 antibody

IGF2 Antibody

DF6810 200ul
EUR 304
Description: IGF2 Antibody detects endogenous levels of total IGF2.

IGF2 Antibody

DF2516 200ul
EUR 304
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody

CSB-PA011088KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

IGF2 Antibody

CSB-PA011088KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

anti-IGF2

YF-PA12620 50 ug
EUR 363
Description: Mouse polyclonal to IGF2

anti-IGF2

YF-PA12621 100 ug
EUR 403
Description: Rabbit polyclonal to IGF2

IGF2 Conjugated Antibody

C49302 100ul
EUR 397

IGF2 Blocking Peptide

BF0039-BP 1mg
EUR 195

IGF2 cloning plasmid

CSB-CL011088HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgt
  • Show more
Description: A cloning plasmid for the IGF2 gene.

IGF2 cloning plasmid

CSB-CL011088HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacct
  • Show more
Description: A cloning plasmid for the IGF2 gene.

IGF2 Polyclonal Antibody

ES10707-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2 Polyclonal Antibody

ES10707-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA