  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG5 Antibody

ABD9561 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG5 antibody

70R-35411 100 ug
EUR 327
Description: Purified Rabbit polyclonal GNG5 antibody

GNG5 Antibody

34726-100ul 100ul
EUR 252

GNG5 Antibody

34726-50ul 50ul
EUR 187

GNG5 Antibody

46007-100ul 100ul
EUR 252

GNG5 Antibody

46007-50ul 50ul
EUR 187

GNG5 Antibody

DF9561 200ul
EUR 304
Description: GNG5 Antibody detects endogenous levels of total GNG5.

GNG5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

GNG5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG5 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

GNG5 Antibody

CSB-PA032886-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500


YF-PA23796 50 ul
EUR 334
Description: Mouse polyclonal to GNG5

GNG5 Conjugated Antibody

C46007 100ul
EUR 397

GNG5 Conjugated Antibody

C34726 100ul
EUR 397

GNG5 cloning plasmid

CSB-CL009617HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atgtctggctcctccagcgtcgccgctatgaagaaagtggttcaacagctccggctggaggccggactcaaccgcgtaaaagtttcccaggcagctgcagacttgaaacagttctgtctgcagaatgctcaacatgaccctctgctgactggagtatcttcaagtacaaatccctt
  • Show more
Description: A cloning plasmid for the GNG5 gene.

GNG5 Polyclonal Antibody

A62674 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-GNG5 Antibody

A30716 100ul
EUR 397
Description: Rabbit Polyclonal GNG5 Antibody. Validated in IF and tested in Human, Mouse, Rat.

GNG5 Blocking Peptide

DF9561-BP 1mg
EUR 195

Anti-GNG5 (3B8)

YF-MA13277 100 ug
EUR 363
Description: Mouse monoclonal to GNG5

Rat GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-47374h 96 Tests
EUR 824


ELI-48622b 96 Tests
EUR 928

Mouse Gng5 ELISA KIT

ELI-48747m 96 Tests
EUR 865

Mouse GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG5 Recombinant Protein (Human)

RP013552 100 ug Ask for price

GNG5 Recombinant Protein (Rat)

RP203027 100 ug Ask for price

GNG5 Recombinant Protein (Mouse)

RP139034 100 ug Ask for price

Polyclonal GNG5 Antibody (C-Term)

APR16188G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG5 (C-Term). This antibody is tested and proven to work in the following applications:

GNG5 Polyclonal Antibody, HRP Conjugated

A62675 100 µg
EUR 570.55
Description: The best epigenetics products

GNG5 Polyclonal Antibody, FITC Conjugated

A62676 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG5 Polyclonal Antibody, Biotin Conjugated

A62677 100 µg
EUR 570.55
Description: fast delivery possible

GNG5 ORF Vector (Human) (pORF)

ORF004518 1.0 ug DNA
EUR 95

Gng5 ORF Vector (Rat) (pORF)

ORF067677 1.0 ug DNA
EUR 506

Gng5 ORF Vector (Mouse) (pORF)

ORF046346 1.0 ug DNA
EUR 506

GNG5 sgRNA CRISPR Lentivector set (Human)

K0876901 3 x 1.0 ug
EUR 339

Gng5 sgRNA CRISPR Lentivector set (Mouse)

K4937101 3 x 1.0 ug
EUR 339

Gng5 sgRNA CRISPR Lentivector set (Rat)

K7024301 3 x 1.0 ug
EUR 339

GNG5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876902 1.0 ug DNA
EUR 154

GNG5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876903 1.0 ug DNA
EUR 154

GNG5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876904 1.0 ug DNA
EUR 154

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

abx331294-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4937102 1.0 ug DNA
EUR 154

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4937103 1.0 ug DNA
EUR 154

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4937104 1.0 ug DNA
EUR 154

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7024302 1.0 ug DNA
EUR 154

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7024303 1.0 ug DNA
EUR 154

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7024304 1.0 ug DNA
EUR 154

GNG5 Protein Vector (Mouse) (pPB-C-His)

PV185382 500 ng
EUR 603

GNG5 Protein Vector (Mouse) (pPB-N-His)

PV185383 500 ng
EUR 603

GNG5 Protein Vector (Mouse) (pPM-C-HA)

PV185384 500 ng
EUR 603