Orla Protein Technologies

Multiple Diagnoses Pictures

EIF2S3

EIF2S3 antibody
70R-17045 50 ul
EUR 435
Description: Rabbit polyclonal EIF2S3 antibody

EIF2S3 antibody
70R-1058 100 ug
EUR 377
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 antibody
70R-2892 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 Antibody
47253-100ul 100ul
EUR 252

EIF2S3 Antibody
DF12974 200ul
EUR 304
Description: EIF2S3 Antibody detects endogenous levels of EIF2S3.

EIF2S3 antibody
70R-36621 100 ug
EUR 349
Description: Rabbit Polyclonal EIF2S3 antibody

EIF2S3 Antibody
1-CSB-PA007528ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody
1-CSB-PA007528ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody
1-CSB-PA007528GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF2S3 siRNA
20-abx915155
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2S3 Blocking Peptide
33R-4841 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S3 antibody, catalog no. 70R-1058

EIF2S3 Blocking Peptide
33R-1197 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRM6 antibody, catalog no. 70R-9576

EIF2S3 Blocking Peptide
DF12974-BP 1mg
EUR 195

EIF2S3 Conjugated Antibody
C47253 100ul
EUR 397

EIF2S3 cloning plasmid
CSB-CL007528HU-10ug 10ug
EUR 507
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1419
  • Sequence: atggcgggcggagaagctggagtgactctagggcagccgcatctttcgcgtcaggatctcaccaccttggatgttaccaagttgacgccactttcacacgaagttatcagcagacaagccacaattaacataggtacaattggtcatgtagctcatgggaaatccacagtcgtca
  • Show more
Description: A cloning plasmid for the EIF2S3 gene.

EIF2S3 Rabbit pAb
A3848-100ul 100 ul
EUR 308

EIF2S3 Rabbit pAb
A3848-200ul 200 ul
EUR 459

EIF2S3 Rabbit pAb
A3848-20ul 20 ul
EUR 183

EIF2S3 Rabbit pAb
A3848-50ul 50 ul
EUR 223

EIF2S3 Rabbit pAb
A6581-100ul 100 ul
EUR 308

EIF2S3 Rabbit pAb
A6581-200ul 200 ul
EUR 459

EIF2S3 Rabbit pAb
A6581-20ul 20 ul
EUR 183

EIF2S3 Rabbit pAb
A6581-50ul 50 ul
EUR 223

anti- EIF2S3 antibody
FNab02701 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
  • Uniprot ID: P41091
  • Gene ID: 1968
  • Research Area: Metabolism
Description: Antibody raised against EIF2S3

Anti-EIF2S3 antibody
PAab02701 100 ug
EUR 386

Anti-EIF2S3 antibody
STJ28664 100 µl
EUR 277
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.

Anti-EIF2S3 antibody
STJ23510 100 µl
EUR 277
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.

Human EIF2S3 ELISA KIT
ELI-20270h 96 Tests
EUR 824

Chicken EIF2S3 ELISA KIT
ELI-21435c 96 Tests
EUR 928

EIF2S3 ELISA KIT|Human
EF009337 96 Tests
EUR 689

Human EIF2S3 shRNA Plasmid
20-abx951362
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine EIF2S3 ELISA KIT
ELI-48207b 96 Tests
EUR 928

pCMV-SPORT6-EIF2S3 Plasmid
PVT16227 2 ug
EUR 325

EIF2S3 Recombinant Protein (Human)
RP010393 100 ug Ask for price

EIF2S3 ORF Vector (Human) (pORF)
ORF003465 1.0 ug DNA
EUR 95

EIF2S3 sgRNA CRISPR Lentivector set (Human)
K0666901 3 x 1.0 ug
EUR 339

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0666902 1.0 ug DNA
EUR 154

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0666903 1.0 ug DNA
EUR 154

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0666904 1.0 ug DNA
EUR 154

EIF2S3 Protein Vector (Human) (pPB-C-His)
PV013857 500 ng
EUR 329

EIF2S3 Protein Vector (Human) (pPB-N-His)
PV013858 500 ng
EUR 329

EIF2S3 Protein Vector (Human) (pPM-C-HA)
PV013859 500 ng
EUR 329

EIF2S3 Protein Vector (Human) (pPM-C-His)
PV013860 500 ng
EUR 329

EIF2S3 3'UTR GFP Stable Cell Line
TU056727 1.0 ml
EUR 1394

EIF2S3 3'UTR Luciferase Stable Cell Line
TU006727 1.0 ml
EUR 1394

EIF2S3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV791545 1.0 ug DNA
EUR 316

EIF2S3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV791546 1.0 ug DNA
EUR 316

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
20-abx006825
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
20-abx002795
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
20-abx112361
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
abx036559-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (eIF2S3) Antibody
20-abx141883
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
abx030059-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
abx030059-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
20-abx321796
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
20-abx321797
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody
abx232701-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EIF2S3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0666905 3 x 1.0 ug
EUR 376

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E02E0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E02E0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E02E0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E03E0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E03E0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E03E0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E01E0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E01E0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E01E0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E06E0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E06E0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit
E06E0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.