EIF2B4

EIF2B4 Antibody

ABD4577 100 ug
EUR 438.00

EIF2B4 Antibody

35107-100ul 100ul
EUR 252.00

EIF2B4 Antibody

35107-50ul 50ul
EUR 187.00

EIF2B4 siRNA

20-abx915145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B4 siRNA

20-abx915146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B4 siRNA

20-abx901674
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B4 antibody

70R-36819 100 ug
EUR 349.00
Description: Rabbit Polyclonal EIF2B4 antibody

EIF2B4 antibody

70R-17041 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF2B4 antibody

EIF2B4 Antibody

CSB-PA933060-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody

CSB-PA933060-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody

1-CSB-PA010573
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

EIF2B4 Antibody

1-CSB-PA007517GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF2B4 Antibody

DF4577 200ul
EUR 304.00
Description: EIF2B4 Antibody detects endogenous levels of total EIF2B4.

EIF2B4 Blocking Peptide

20-abx161838
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EIF2B4 Conjugated Antibody

C35107 100ul
EUR 397.00

anti- EIF2B4 antibody

FNab02696 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
  • Uniprot ID: Q9UI10
  • Gene ID: 8890
  • Research Area: Metabolism
Description: Antibody raised against EIF2B4

EIF2B4 Rabbit pAb

A18203-100ul 100 ul
EUR 308.00

EIF2B4 Rabbit pAb

A18203-200ul 200 ul
EUR 459.00

EIF2B4 Rabbit pAb

A18203-20ul 20 ul
EUR 183.00

EIF2B4 Rabbit pAb

A18203-50ul 50 ul
EUR 223.00

EIF2B4 cloning plasmid

CSB-CL887053HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1572
  • Sequence: atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccag
  • Show more
Description: A cloning plasmid for the EIF2B4 gene.

EIF2B4 Blocking Peptide

DF4577-BP 1mg
EUR 195.00

Anti-EIF2B4 antibody

PAab02696 100 ug
EUR 355.00

Anti-EIF2B4 antibody

STJ11100161 100 µl
EUR 277.00
Description: Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2B4 antibody

STJ72304 100 µg
EUR 359.00

Rat EIF2B4 shRNA Plasmid

20-abx987370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2B4 shRNA Plasmid

20-abx955875
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif2b4 ELISA KIT

ELI-08648m 96 Tests
EUR 865.00

Human EIF2B4 ELISA KIT

ELI-32260h 96 Tests
EUR 824.00

Bovine EIF2B4 ELISA KIT

ELI-47580b 96 Tests
EUR 928.00

EIF2B4 ELISA KIT|Human

EF009332 96 Tests
EUR 689.00

Mouse EIF2B4 shRNA Plasmid

20-abx970141
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF2B4 Recombinant Protein (Human)

RP010372 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131225 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131228 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131231 100 ug Ask for price

EIF2B4 Recombinant Protein (Rat)

RP199310 100 ug Ask for price

EIF2B4 ORF Vector (Human) (pORF)

ORF003458 1.0 ug DNA
EUR 95.00

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043743 1.0 ug DNA
EUR 506.00

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043744 1.0 ug DNA
EUR 506.00

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043745 1.0 ug DNA
EUR 506.00

Eif2b4 ORF Vector (Rat) (pORF)

ORF066438 1.0 ug DNA
EUR 506.00

EIF2B4 sgRNA CRISPR Lentivector set (Human)

K0665801 3 x 1.0 ug
EUR 339.00

Eif2b4 sgRNA CRISPR Lentivector set (Mouse)

K4617201 3 x 1.0 ug
EUR 339.00

Eif2b4 sgRNA CRISPR Lentivector set (Rat)

K7122801 3 x 1.0 ug
EUR 339.00

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665802 1.0 ug DNA
EUR 154.00

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665803 1.0 ug DNA
EUR 154.00

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665804 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4617202 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4617203 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4617204 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7122802 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7122803 1.0 ug DNA
EUR 154.00

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7122804 1.0 ug DNA
EUR 154.00

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174970 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174971 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174972 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174973 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174974 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174975 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174976 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174977 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174978 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174979 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174980 500 ng
EUR 603.00

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174981 500 ng
EUR 603.00

EIF2B4 Protein Vector (Human) (pPB-C-His)

PV013829 500 ng
EUR 329.00

EIF2B4 Protein Vector (Human) (pPB-N-His)

PV013830 500 ng
EUR 329.00

EIF2B4 Protein Vector (Human) (pPM-C-HA)

PV013831 500 ng
EUR 329.00

EIF2B4 Protein Vector (Human) (pPM-C-His)

PV013832 500 ng
EUR 329.00